Incidental Mutation 'R5704:Pdzd2'
ID451880
Institutional Source Beutler Lab
Gene Symbol Pdzd2
Ensembl Gene ENSMUSG00000022197
Gene NamePDZ domain containing 2
SynonymsPdzk3, A930022H17Rik, 4930537L06Rik, Gm21706, LOC223364
MMRRC Submission 043329-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #R5704 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location12359711-12739924 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 12385675 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1003 (D1003G)
Ref Sequence ENSEMBL: ENSMUSP00000074788 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075317]
Predicted Effect probably benign
Transcript: ENSMUST00000075317
AA Change: D1003G

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000074788
Gene: ENSMUSG00000022197
AA Change: D1003G

DomainStartEndE-ValueType
PDZ 81 179 1.27e-2 SMART
PDZ 342 419 1.51e-18 SMART
PDZ 597 675 5.25e-18 SMART
low complexity region 690 718 N/A INTRINSIC
PDZ 738 817 1.64e-10 SMART
low complexity region 861 869 N/A INTRINSIC
low complexity region 969 984 N/A INTRINSIC
low complexity region 986 1000 N/A INTRINSIC
low complexity region 1436 1459 N/A INTRINSIC
low complexity region 1525 1537 N/A INTRINSIC
low complexity region 1538 1553 N/A INTRINSIC
low complexity region 1567 1586 N/A INTRINSIC
low complexity region 2111 2129 N/A INTRINSIC
low complexity region 2190 2198 N/A INTRINSIC
low complexity region 2335 2354 N/A INTRINSIC
low complexity region 2469 2479 N/A INTRINSIC
PDZ 2589 2666 1.3e-13 SMART
PDZ 2716 2794 9.42e-20 SMART
Meta Mutation Damage Score 0.1092 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 98% (85/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains six PDZ domains and shares sequence similarity with pro-interleukin-16 (pro-IL-16). Like pro-IL-16, the encoded protein localizes to the endoplasmic reticulum and is thought to be cleaved by a caspase to produce a secreted peptide containing two PDZ domains. In addition, this gene is upregulated in primary prostate tumors and may be involved in the early stages of prostate tumorigenesis. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit normal response to acute and chronic pain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg3 G A 5: 104,968,170 A266V probably damaging Het
Acad10 A G 5: 121,631,543 S617P probably benign Het
Ahi1 A C 10: 21,074,427 M126L probably benign Het
Alk T C 17: 72,603,120 E197G probably damaging Het
Alyref2 A T 1: 171,503,979 Y108F probably damaging Het
Ankrd26 T G 6: 118,523,882 H876P probably damaging Het
Arfgef1 T C 1: 10,159,583 T1298A probably damaging Het
Arhgap33 T A 7: 30,519,620 probably benign Het
Arhgef17 A G 7: 100,881,341 S1413P probably damaging Het
Arid1a A T 4: 133,681,739 V1819E unknown Het
Asprv1 A G 6: 86,628,550 N126S probably damaging Het
Atg16l2 T C 7: 101,300,211 Y43C probably damaging Het
Atp13a3 G T 16: 30,321,879 T1160K probably benign Het
Atp1a3 T C 7: 24,997,311 T272A probably damaging Het
Bpifa3 G T 2: 154,137,642 probably null Het
Bri3 T C 5: 144,255,906 V80A probably damaging Het
Ccdc28a T A 10: 18,230,572 E2V probably damaging Het
Ccdc7a T A 8: 128,980,096 probably benign Het
Cds2 G A 2: 132,293,329 V47I probably benign Het
Cela2a G A 4: 141,825,988 probably benign Het
Ckap5 A G 2: 91,576,203 Y783C probably damaging Het
Cmtr1 G C 17: 29,663,243 A23P possibly damaging Het
Crym C A 7: 120,201,940 probably null Het
Def6 T G 17: 28,228,226 D610E probably benign Het
Dnajc15 T C 14: 77,826,458 Y130C probably damaging Het
Dock8 G A 19: 25,174,222 V1560I probably damaging Het
Eif4g3 T C 4: 138,190,692 V1501A probably damaging Het
Esyt1 A G 10: 128,511,510 S1049P probably damaging Het
Gm4952 G T 19: 12,626,911 R229L probably damaging Het
Gm5724 T C 6: 141,713,254 M539V probably benign Het
Golga5 T A 12: 102,489,448 H548Q probably benign Het
Gspt1 A T 16: 11,228,193 D449E possibly damaging Het
Gtf3c2 T A 5: 31,159,110 D732V probably damaging Het
Hax1 T A 3: 89,996,096 Q168L probably damaging Het
Hectd2 T A 19: 36,598,891 S91T possibly damaging Het
Igfbp2 T A 1: 72,852,144 H300Q probably benign Het
Il12rb2 T C 6: 67,292,213 N538S possibly damaging Het
Insr G A 8: 3,185,122 P124L possibly damaging Het
Irak3 C A 10: 120,145,689 R437L probably benign Het
Jhy C T 9: 40,897,438 V676I probably damaging Het
Kcns3 G A 12: 11,092,327 R124C probably benign Het
Lactb G A 9: 66,955,776 R519* probably null Het
Mdfic G A 6: 15,770,292 G94D probably damaging Het
Mospd3 A G 5: 137,600,351 V42A possibly damaging Het
Mov10 A G 3: 104,799,596 V666A probably benign Het
Mucl1 T C 15: 103,755,397 I15V probably benign Het
Mug1 T A 6: 121,851,433 V268D possibly damaging Het
Myo5c T A 9: 75,272,903 S709T probably benign Het
Nol11 T A 11: 107,173,369 E519V probably benign Het
Nrp2 A T 1: 62,785,108 I791L probably benign Het
Nudt19 A G 7: 35,551,547 Y256H probably benign Het
Nudt8 C T 19: 4,000,777 R42C probably damaging Het
Olfr198 A G 16: 59,202,006 L140P probably damaging Het
Olfr806 T A 10: 129,738,816 I34F probably benign Het
Pcdhga12 A G 18: 37,767,369 Y418C probably damaging Het
Pds5a A G 5: 65,627,079 probably null Het
Pglyrp4 T A 3: 90,740,274 probably null Het
Phip T C 9: 82,871,355 N1779D probably damaging Het
Postn G T 3: 54,372,106 C335F probably damaging Het
Ppp4r3a T C 12: 101,083,360 probably benign Het
Prrt2 C T 7: 127,019,418 V292M probably damaging Het
Rpl18 T C 7: 45,720,722 V138A possibly damaging Het
Rps14 G A 18: 60,777,133 probably benign Het
Sbno1 A G 5: 124,395,893 probably null Het
Siah2 T G 3: 58,676,400 K155T probably damaging Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Slc25a39 T A 11: 102,403,394 probably benign Het
Smok2b T A 17: 13,236,344 C464S probably damaging Het
Spata31 G A 13: 64,922,041 V668I probably benign Het
Tbxas1 C A 6: 39,021,133 H212N probably benign Het
Tenm1 A G X: 43,074,695 V107A possibly damaging Het
Thada C T 17: 84,230,901 A1560T probably benign Het
Tmem241 G C 18: 12,064,206 F65L probably damaging Het
Ttc16 C G 2: 32,769,125 E321Q probably damaging Het
Ttn A T 2: 76,918,585 L4040H possibly damaging Het
Tyw1 G A 5: 130,282,022 W437* probably null Het
Unc79 T A 12: 103,001,943 Y143N probably damaging Het
Urb2 C T 8: 124,038,182 R1310W probably damaging Het
Vmn2r4 T C 3: 64,409,949 I34V probably benign Het
Zfp513 C T 5: 31,200,666 C121Y possibly damaging Het
Zfp606 T G 7: 12,493,529 W468G probably damaging Het
Zfyve16 C T 13: 92,504,471 probably null Het
Other mutations in Pdzd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Pdzd2 APN 15 12457983 missense possibly damaging 0.93
IGL00586:Pdzd2 APN 15 12365767 splice site probably null
IGL00697:Pdzd2 APN 15 12373647 missense possibly damaging 0.81
IGL00721:Pdzd2 APN 15 12374412 missense probably benign 0.00
IGL00971:Pdzd2 APN 15 12374718 missense probably benign 0.00
IGL01066:Pdzd2 APN 15 12402632 unclassified probably benign
IGL01389:Pdzd2 APN 15 12374626 missense possibly damaging 0.56
IGL01505:Pdzd2 APN 15 12458207 missense probably damaging 1.00
IGL01527:Pdzd2 APN 15 12445664 missense probably damaging 1.00
IGL01584:Pdzd2 APN 15 12592483 missense probably damaging 1.00
IGL01763:Pdzd2 APN 15 12372546 missense probably benign
IGL01915:Pdzd2 APN 15 12371639 missense probably damaging 1.00
IGL01947:Pdzd2 APN 15 12592354 missense probably damaging 1.00
IGL02058:Pdzd2 APN 15 12376296 missense possibly damaging 0.87
IGL02274:Pdzd2 APN 15 12445649 missense probably damaging 1.00
IGL02408:Pdzd2 APN 15 12375765 missense probably benign 0.00
IGL02600:Pdzd2 APN 15 12411019 missense probably damaging 1.00
IGL02637:Pdzd2 APN 15 12385634 missense probably benign 0.13
IGL02639:Pdzd2 APN 15 12592243 missense probably damaging 1.00
IGL02712:Pdzd2 APN 15 12376027 missense probably benign 0.00
IGL02967:Pdzd2 APN 15 12374341 missense probably benign 0.04
IGL02992:Pdzd2 APN 15 12382622 missense possibly damaging 0.77
IGL03005:Pdzd2 APN 15 12385265 missense probably damaging 1.00
IGL03067:Pdzd2 APN 15 12388542 critical splice donor site probably null
IGL03335:Pdzd2 APN 15 12373764 missense probably benign 0.00
PIT4280001:Pdzd2 UTSW 15 12399288 missense probably damaging 1.00
R0022:Pdzd2 UTSW 15 12371605 missense possibly damaging 0.94
R0241:Pdzd2 UTSW 15 12367941 missense probably damaging 1.00
R0241:Pdzd2 UTSW 15 12367941 missense probably damaging 1.00
R0446:Pdzd2 UTSW 15 12375024 missense probably benign 0.43
R0462:Pdzd2 UTSW 15 12592160 missense probably damaging 1.00
R0562:Pdzd2 UTSW 15 12592278 missense probably damaging 1.00
R0589:Pdzd2 UTSW 15 12376299 missense probably benign 0.03
R0639:Pdzd2 UTSW 15 12458058 missense possibly damaging 0.77
R0925:Pdzd2 UTSW 15 12399270 missense probably damaging 1.00
R1015:Pdzd2 UTSW 15 12374508 missense probably damaging 1.00
R1054:Pdzd2 UTSW 15 12371639 missense probably damaging 1.00
R1070:Pdzd2 UTSW 15 12389966 critical splice donor site probably null
R1099:Pdzd2 UTSW 15 12373087 missense probably damaging 1.00
R1122:Pdzd2 UTSW 15 12457895 missense probably benign 0.25
R1126:Pdzd2 UTSW 15 12458220 missense possibly damaging 0.94
R1381:Pdzd2 UTSW 15 12385439 missense probably benign 0.02
R1385:Pdzd2 UTSW 15 12411022 missense probably benign 0.38
R1513:Pdzd2 UTSW 15 12373829 missense possibly damaging 0.88
R1538:Pdzd2 UTSW 15 12372961 missense probably damaging 1.00
R1750:Pdzd2 UTSW 15 12385864 missense probably damaging 1.00
R1775:Pdzd2 UTSW 15 12592460 missense probably damaging 1.00
R1801:Pdzd2 UTSW 15 12387654 missense possibly damaging 0.56
R1832:Pdzd2 UTSW 15 12390048 missense probably damaging 1.00
R1856:Pdzd2 UTSW 15 12373855 missense possibly damaging 0.87
R1870:Pdzd2 UTSW 15 12457886 missense probably damaging 1.00
R1879:Pdzd2 UTSW 15 12373900 missense possibly damaging 0.61
R2072:Pdzd2 UTSW 15 12385819 missense probably damaging 1.00
R2073:Pdzd2 UTSW 15 12385819 missense probably damaging 1.00
R2075:Pdzd2 UTSW 15 12385819 missense probably damaging 1.00
R2125:Pdzd2 UTSW 15 12373590 missense probably benign 0.37
R2142:Pdzd2 UTSW 15 12406559 missense probably damaging 1.00
R2155:Pdzd2 UTSW 15 12375793 missense probably benign 0.43
R2282:Pdzd2 UTSW 15 12373848 missense possibly damaging 0.95
R2407:Pdzd2 UTSW 15 12373161 missense probably damaging 1.00
R3545:Pdzd2 UTSW 15 12375471 missense probably benign 0.00
R3878:Pdzd2 UTSW 15 12376176 missense probably benign 0.00
R3879:Pdzd2 UTSW 15 12375508 missense probably damaging 1.00
R4396:Pdzd2 UTSW 15 12387646 missense probably benign 0.36
R4398:Pdzd2 UTSW 15 12375975 missense probably benign 0.30
R4491:Pdzd2 UTSW 15 12385637 missense possibly damaging 0.75
R4492:Pdzd2 UTSW 15 12385637 missense possibly damaging 0.75
R4492:Pdzd2 UTSW 15 12419481 missense possibly damaging 0.48
R4656:Pdzd2 UTSW 15 12385711 missense probably benign 0.00
R4715:Pdzd2 UTSW 15 12419516 missense possibly damaging 0.72
R4803:Pdzd2 UTSW 15 12374595 missense probably benign 0.04
R4893:Pdzd2 UTSW 15 12385343 missense probably benign 0.00
R4959:Pdzd2 UTSW 15 12375648 missense probably damaging 1.00
R4973:Pdzd2 UTSW 15 12375648 missense probably damaging 1.00
R5030:Pdzd2 UTSW 15 12592408 nonsense probably null
R5174:Pdzd2 UTSW 15 12372514 missense probably benign 0.01
R5230:Pdzd2 UTSW 15 12390033 missense probably damaging 1.00
R5256:Pdzd2 UTSW 15 12372942 missense possibly damaging 0.87
R5268:Pdzd2 UTSW 15 12592177 missense probably damaging 1.00
R5488:Pdzd2 UTSW 15 12382676 missense probably benign 0.00
R5489:Pdzd2 UTSW 15 12382676 missense probably benign 0.00
R5588:Pdzd2 UTSW 15 12374281 missense possibly damaging 0.48
R5605:Pdzd2 UTSW 15 12592350 nonsense probably null
R5858:Pdzd2 UTSW 15 12442589 missense probably damaging 0.97
R6048:Pdzd2 UTSW 15 12592570 unclassified probably null
R6222:Pdzd2 UTSW 15 12374566 missense probably damaging 1.00
R6311:Pdzd2 UTSW 15 12458188 missense probably damaging 1.00
R6734:Pdzd2 UTSW 15 12592465 missense probably damaging 1.00
R6897:Pdzd2 UTSW 15 12385865 missense probably damaging 1.00
R6900:Pdzd2 UTSW 15 12374037 missense probably benign
R6955:Pdzd2 UTSW 15 12401464 missense probably damaging 1.00
R6959:Pdzd2 UTSW 15 12375907 missense probably benign 0.17
R6992:Pdzd2 UTSW 15 12457859 missense probably damaging 1.00
R7014:Pdzd2 UTSW 15 12372561 missense probably benign 0.13
R7014:Pdzd2 UTSW 15 12372975 missense probably benign 0.14
R7110:Pdzd2 UTSW 15 12368013 missense probably damaging 1.00
R7180:Pdzd2 UTSW 15 12376123 missense probably damaging 0.99
R7228:Pdzd2 UTSW 15 12372973 missense probably benign 0.01
R7228:Pdzd2 UTSW 15 12458145 nonsense probably null
R7317:Pdzd2 UTSW 15 12592243 missense probably damaging 1.00
R7322:Pdzd2 UTSW 15 12437162 missense probably damaging 1.00
R7349:Pdzd2 UTSW 15 12399205 missense probably damaging 1.00
R7600:Pdzd2 UTSW 15 12372734 missense probably damaging 1.00
R7663:Pdzd2 UTSW 15 12373203 missense probably damaging 1.00
R7712:Pdzd2 UTSW 15 12407336 missense probably damaging 1.00
R7716:Pdzd2 UTSW 15 12373374 missense possibly damaging 0.63
R7740:Pdzd2 UTSW 15 12374016 missense probably benign 0.00
R7748:Pdzd2 UTSW 15 12385786 missense possibly damaging 0.60
R8017:Pdzd2 UTSW 15 12373036 missense probably damaging 1.00
R8019:Pdzd2 UTSW 15 12373036 missense probably damaging 1.00
R8108:Pdzd2 UTSW 15 12373506 missense probably benign 0.01
R8109:Pdzd2 UTSW 15 12373506 missense probably benign 0.01
R8110:Pdzd2 UTSW 15 12373506 missense probably benign 0.01
R8111:Pdzd2 UTSW 15 12373506 missense probably benign 0.01
R8145:Pdzd2 UTSW 15 12407372 missense probably benign 0.37
R8220:Pdzd2 UTSW 15 12592163 missense probably damaging 0.99
R8278:Pdzd2 UTSW 15 12375909 missense probably benign
X0057:Pdzd2 UTSW 15 12411027 missense probably damaging 1.00
X0063:Pdzd2 UTSW 15 12368719 missense possibly damaging 0.77
X0066:Pdzd2 UTSW 15 12372856 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTTCTACAGAGCCTGGCAGG -3'
(R):5'- GCTCTTACACAAGCAAGTGAC -3'

Sequencing Primer
(F):5'- GCTGGCTGCCTTGGGAG -3'
(R):5'- AGCAAGTGACAGTCGCTC -3'
Posted On2017-01-03