Incidental Mutation 'R5705:Ndufs1'
ID451897
Institutional Source Beutler Lab
Gene Symbol Ndufs1
Ensembl Gene ENSMUSG00000025968
Gene NameNADH dehydrogenase (ubiquinone) Fe-S protein 1
Synonyms9930026A05Rik, 5830412M15Rik
MMRRC Submission 043330-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5705 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location63143596-63176833 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 63147158 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 46 (V46A)
Ref Sequence ENSEMBL: ENSMUSP00000140072 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027111] [ENSMUST00000168099] [ENSMUST00000185847] [ENSMUST00000187756]
Predicted Effect probably benign
Transcript: ENSMUST00000027111
AA Change: V685A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000027111
Gene: ENSMUSG00000025968
AA Change: V685A

DomainStartEndE-ValueType
Pfam:Fer2_4 29 107 8.5e-20 PFAM
Pfam:Fer2 34 97 1e-11 PFAM
NADH-G_4Fe-4S_3 113 153 6.5e-19 SMART
Pfam:Molybdopterin 301 629 1e-76 PFAM
Pfam:NADH_dhqG_C 658 710 1.5e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138611
Predicted Effect probably benign
Transcript: ENSMUST00000168099
AA Change: V685A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000126621
Gene: ENSMUSG00000025968
AA Change: V685A

DomainStartEndE-ValueType
Pfam:Fer2_4 29 107 4.3e-19 PFAM
Pfam:Fer2 34 97 1e-11 PFAM
NADH-G_4Fe-4S_3 113 153 6.5e-19 SMART
Pfam:Molybdopterin 301 629 1e-76 PFAM
Pfam:DUF1982 657 710 3.6e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000185847
SMART Domains Protein: ENSMUSP00000141190
Gene: ENSMUSG00000025968

DomainStartEndE-ValueType
Pfam:Molybdopterin 1 60 5.7e-5 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186569
Predicted Effect probably benign
Transcript: ENSMUST00000187756
AA Change: V46A

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187835
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188602
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190095
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the complex I 75 kDa subunit family. Mammalian complex I is composed of 45 different subunits. It locates at the mitochondrial inner membrane. This protein has NADH dehydrogenase activity and oxidoreductase activity. It transfers electrons from NADH to the respiratory chain. The immediate electron acceptor for the enzyme is believed to be ubiquinone. This protein is the largest subunit of complex I and it is a component of the iron-sulfur (IP) fragment of the enzyme. It may form part of the active site crevice where NADH is oxidized. Mutations in this gene are associated with complex I deficiency. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2011]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T C 10: 80,015,442 V2163A probably benign Het
Abcg3 G A 5: 104,968,170 A266V probably damaging Het
Ago1 T C 4: 126,448,794 I519V probably benign Het
Arhgap4 G A X: 73,906,817 R43W probably damaging Het
Aurkb T A 11: 69,048,815 L213I possibly damaging Het
Bod1l T A 5: 41,817,002 Q2323L probably benign Het
Ccdc17 C T 4: 116,596,869 T28I probably benign Het
Ccdc39 T C 3: 33,816,937 E630G probably damaging Het
Cnih4 A G 1: 181,153,735 I24V probably benign Het
Ctse C A 1: 131,664,374 T146K possibly damaging Het
Ctsr A G 13: 61,161,264 F226L probably damaging Het
Cyp2a22 T C 7: 26,939,215 N49D probably benign Het
Defb23 C T 2: 152,459,284 A123T probably benign Het
Dtx2 C A 5: 136,010,295 D69E probably damaging Het
Eps8l1 T C 7: 4,470,035 V91A probably benign Het
Eps8l3 C A 3: 107,891,264 Q489K probably benign Het
Esyt3 A G 9: 99,318,207 S645P probably benign Het
Fam161a T A 11: 23,028,869 M472K unknown Het
Fam196b A G 11: 34,404,349 Y473C probably damaging Het
Fam26e A T 10: 34,095,993 C149S probably damaging Het
Glp2r A G 11: 67,709,739 V428A probably benign Het
Gnl1 G A 17: 35,981,600 V191I probably benign Het
Hfm1 T C 5: 106,911,453 I234M probably benign Het
Hlx T C 1: 184,730,865 T197A probably benign Het
Hs3st2 T C 7: 121,393,082 L85P probably damaging Het
Igsf9 T C 1: 172,494,771 V511A possibly damaging Het
Kcnma1 A T 14: 24,003,771 C54S possibly damaging Het
Klhdc4 A G 8: 121,804,993 V181A probably benign Het
Ldb3 T C 14: 34,577,029 M213V probably null Het
Mertk C A 2: 128,771,401 Q446K probably benign Het
Neurod4 A G 10: 130,271,402 M1T probably null Het
Nlrc5 T A 8: 94,475,757 C162S probably benign Het
Pald1 A G 10: 61,323,297 I785T possibly damaging Het
Pcmt1 T C 10: 7,638,190 I224M possibly damaging Het
Pisd C T 5: 32,737,363 R533H probably benign Het
Plcxd3 C A 15: 4,517,194 Q227K probably benign Het
Polr1b A T 2: 129,105,351 K199* probably null Het
Ppp1r10 T C 17: 35,929,489 V557A probably damaging Het
Ralgapa2 A G 2: 146,449,273 Y248H probably damaging Het
Rsrp1 T C 4: 134,924,020 S32P unknown Het
Setdb2 T G 14: 59,423,365 S110R possibly damaging Het
Srcin1 A G 11: 97,548,951 C152R probably benign Het
Syk A G 13: 52,611,047 N70S probably benign Het
Tlr4 T A 4: 66,833,980 D59E probably damaging Het
Tm9sf4 T A 2: 153,182,458 I67N probably benign Het
Trim30b T A 7: 104,357,577 Y24F probably damaging Het
Tsga13 A G 6: 30,900,016 S189P probably damaging Het
Tspan33 A G 6: 29,717,233 D210G probably benign Het
Use1 G T 8: 71,369,687 R278L probably damaging Het
Wwc1 T C 11: 35,876,596 N403D probably damaging Het
Zfp263 C T 16: 3,746,454 P203S probably benign Het
Other mutations in Ndufs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01082:Ndufs1 APN 1 63164817 missense probably damaging 0.99
IGL01655:Ndufs1 APN 1 63151557 missense probably damaging 1.00
IGL02532:Ndufs1 APN 1 63170139 missense probably damaging 0.99
IGL02606:Ndufs1 APN 1 63159852 missense probably damaging 1.00
IGL02866:Ndufs1 APN 1 63147141 missense probably benign 0.00
IGL03036:Ndufs1 APN 1 63163696 nonsense probably null
IGL03209:Ndufs1 APN 1 63164737 missense probably damaging 1.00
PIT4142001:Ndufs1 UTSW 1 63159748 unclassified probably benign
R0165:Ndufs1 UTSW 1 63159748 critical splice donor site probably null
R0505:Ndufs1 UTSW 1 63143926 splice site probably benign
R1861:Ndufs1 UTSW 1 63147417 missense probably benign 0.17
R2294:Ndufs1 UTSW 1 63160996 missense probably damaging 1.00
R2872:Ndufs1 UTSW 1 63164723 splice site probably benign
R2873:Ndufs1 UTSW 1 63164723 splice site probably benign
R4092:Ndufs1 UTSW 1 63157246 missense possibly damaging 0.55
R4277:Ndufs1 UTSW 1 63170097 missense possibly damaging 0.84
R4782:Ndufs1 UTSW 1 63160949 missense probably damaging 1.00
R4799:Ndufs1 UTSW 1 63160949 missense probably damaging 1.00
R4993:Ndufs1 UTSW 1 63163776 missense probably benign
R5051:Ndufs1 UTSW 1 63164947 critical splice donor site probably null
R5412:Ndufs1 UTSW 1 63166349 missense possibly damaging 0.79
R5632:Ndufs1 UTSW 1 63150059 missense probably benign 0.00
R5854:Ndufs1 UTSW 1 63147389 missense probably benign 0.05
R5919:Ndufs1 UTSW 1 63143832 makesense probably null
R6598:Ndufs1 UTSW 1 63164950 missense probably null 1.00
R7716:Ndufs1 UTSW 1 63152857 missense possibly damaging 0.95
R7744:Ndufs1 UTSW 1 63160940 missense possibly damaging 0.89
R7785:Ndufs1 UTSW 1 63147399 missense probably damaging 0.98
R8108:Ndufs1 UTSW 1 63150012 missense possibly damaging 0.47
Z1176:Ndufs1 UTSW 1 63163836 missense probably damaging 1.00
Z1177:Ndufs1 UTSW 1 63163808 missense probably damaging 1.00
Z1177:Ndufs1 UTSW 1 63169251 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CACTCTTCATGGTGAGCGTATG -3'
(R):5'- AGGTCTCTCCTAATCTGGTTCG -3'

Sequencing Primer
(F):5'- CATGGTGAGCGTATGCCTGC -3'
(R):5'- TCTCCTAATCTGGTTCGATATGATG -3'
Posted On2017-01-03