Incidental Mutation 'R5705:Ctse'
ID451898
Institutional Source Beutler Lab
Gene Symbol Ctse
Ensembl Gene ENSMUSG00000004552
Gene Namecathepsin E
SynonymsCatE, C920004C08Rik, CE, A430072O03Rik
MMRRC Submission 043330-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5705 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location131638306-131675505 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 131664374 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 146 (T146K)
Ref Sequence ENSEMBL: ENSMUSP00000108030 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073350] [ENSMUST00000112411]
Predicted Effect possibly damaging
Transcript: ENSMUST00000073350
AA Change: T146K

PolyPhen 2 Score 0.752 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000073072
Gene: ENSMUSG00000004552
AA Change: T146K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:A1_Propeptide 22 50 7e-14 PFAM
Pfam:Asp 78 395 2.1e-129 PFAM
Pfam:TAXi_N 79 236 1.3e-11 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000112411
AA Change: T146K

PolyPhen 2 Score 0.818 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000108030
Gene: ENSMUSG00000004552
AA Change: T146K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:A1_Propeptide 22 50 2.7e-12 PFAM
Pfam:Asp 78 315 2e-99 PFAM
Pfam:TAXi_N 79 236 6.1e-14 PFAM
Pfam:Asp 310 362 6.8e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141061
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the peptidase A1 family of aspartate proteases and preproprotein that is proteolytically processed to generate a mature protein product. The encoded protein may be involved in antigen processing and the maturation of secretory proteins. Elevated expression of this gene has been observed in neurodegeneration. Homozygous knockout mice for this gene exhibit lysosomal storage disorder, impaired autophagy, mitochondrial abnormalities, dermatitis, and reduced weight gain in an obesity model. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a targeted mutation are viable and fertile, but develop skin lesions on the face, ears, neck and dorsal skin which are similar to those seen in human atopic dermatitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T C 10: 80,015,442 V2163A probably benign Het
Abcg3 G A 5: 104,968,170 A266V probably damaging Het
Ago1 T C 4: 126,448,794 I519V probably benign Het
Arhgap4 G A X: 73,906,817 R43W probably damaging Het
Aurkb T A 11: 69,048,815 L213I possibly damaging Het
Bod1l T A 5: 41,817,002 Q2323L probably benign Het
Ccdc17 C T 4: 116,596,869 T28I probably benign Het
Ccdc39 T C 3: 33,816,937 E630G probably damaging Het
Cnih4 A G 1: 181,153,735 I24V probably benign Het
Ctsr A G 13: 61,161,264 F226L probably damaging Het
Cyp2a22 T C 7: 26,939,215 N49D probably benign Het
Defb23 C T 2: 152,459,284 A123T probably benign Het
Dtx2 C A 5: 136,010,295 D69E probably damaging Het
Eps8l1 T C 7: 4,470,035 V91A probably benign Het
Eps8l3 C A 3: 107,891,264 Q489K probably benign Het
Esyt3 A G 9: 99,318,207 S645P probably benign Het
Fam161a T A 11: 23,028,869 M472K unknown Het
Fam196b A G 11: 34,404,349 Y473C probably damaging Het
Fam26e A T 10: 34,095,993 C149S probably damaging Het
Glp2r A G 11: 67,709,739 V428A probably benign Het
Gnl1 G A 17: 35,981,600 V191I probably benign Het
Hfm1 T C 5: 106,911,453 I234M probably benign Het
Hlx T C 1: 184,730,865 T197A probably benign Het
Hs3st2 T C 7: 121,393,082 L85P probably damaging Het
Igsf9 T C 1: 172,494,771 V511A possibly damaging Het
Kcnma1 A T 14: 24,003,771 C54S possibly damaging Het
Klhdc4 A G 8: 121,804,993 V181A probably benign Het
Ldb3 T C 14: 34,577,029 M213V probably null Het
Mertk C A 2: 128,771,401 Q446K probably benign Het
Ndufs1 A G 1: 63,147,158 V46A probably benign Het
Neurod4 A G 10: 130,271,402 M1T probably null Het
Nlrc5 T A 8: 94,475,757 C162S probably benign Het
Pald1 A G 10: 61,323,297 I785T possibly damaging Het
Pcmt1 T C 10: 7,638,190 I224M possibly damaging Het
Pisd C T 5: 32,737,363 R533H probably benign Het
Plcxd3 C A 15: 4,517,194 Q227K probably benign Het
Polr1b A T 2: 129,105,351 K199* probably null Het
Ppp1r10 T C 17: 35,929,489 V557A probably damaging Het
Ralgapa2 A G 2: 146,449,273 Y248H probably damaging Het
Rsrp1 T C 4: 134,924,020 S32P unknown Het
Setdb2 T G 14: 59,423,365 S110R possibly damaging Het
Srcin1 A G 11: 97,548,951 C152R probably benign Het
Syk A G 13: 52,611,047 N70S probably benign Het
Tlr4 T A 4: 66,833,980 D59E probably damaging Het
Tm9sf4 T A 2: 153,182,458 I67N probably benign Het
Trim30b T A 7: 104,357,577 Y24F probably damaging Het
Tsga13 A G 6: 30,900,016 S189P probably damaging Het
Tspan33 A G 6: 29,717,233 D210G probably benign Het
Use1 G T 8: 71,369,687 R278L probably damaging Het
Wwc1 T C 11: 35,876,596 N403D probably damaging Het
Zfp263 C T 16: 3,746,454 P203S probably benign Het
Other mutations in Ctse
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02151:Ctse APN 1 131672535 missense probably benign 0.00
IGL02492:Ctse APN 1 131668234 missense probably damaging 1.00
R0057:Ctse UTSW 1 131663371 missense probably damaging 1.00
R0057:Ctse UTSW 1 131663371 missense probably damaging 1.00
R0690:Ctse UTSW 1 131674778 splice site probably benign
R2198:Ctse UTSW 1 131672447 nonsense probably null
R4190:Ctse UTSW 1 131662741 missense probably benign 0.02
R4668:Ctse UTSW 1 131662749 missense probably damaging 1.00
R4971:Ctse UTSW 1 131664392 missense probably damaging 1.00
R5070:Ctse UTSW 1 131668179 missense probably damaging 1.00
R5499:Ctse UTSW 1 131672513 nonsense probably null
R7207:Ctse UTSW 1 131664374 missense possibly damaging 0.82
X0067:Ctse UTSW 1 131670772 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCCCATCTTCAACCTAGTG -3'
(R):5'- CTCTAGGTTCAGCATCCTGC -3'

Sequencing Primer
(F):5'- CCATCTTCAACCTAGTGTGGGGAG -3'
(R):5'- ACCGGGCTATCTCAGGTAGAAC -3'
Posted On2017-01-03