Incidental Mutation 'R5705:Eps8l3'
ID451907
Institutional Source Beutler Lab
Gene Symbol Eps8l3
Ensembl Gene ENSMUSG00000040600
Gene NameEPS8-like 3
Synonyms
MMRRC Submission 043330-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5705 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location107877229-107892900 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 107891264 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 489 (Q489K)
Ref Sequence ENSEMBL: ENSMUSP00000042004 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004134] [ENSMUST00000037375] [ENSMUST00000167387] [ENSMUST00000167523] [ENSMUST00000169365] [ENSMUST00000170058] [ENSMUST00000172247]
Predicted Effect probably benign
Transcript: ENSMUST00000004134
SMART Domains Protein: ENSMUSP00000004134
Gene: ENSMUSG00000004032

DomainStartEndE-ValueType
Pfam:GST_N 6 85 4e-23 PFAM
Pfam:GST_C 107 195 1.5e-19 PFAM
Pfam:GST_C_3 113 193 2.9e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000037375
AA Change: Q489K

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000042004
Gene: ENSMUSG00000040600
AA Change: Q489K

DomainStartEndE-ValueType
Pfam:PTB 28 155 3.7e-40 PFAM
low complexity region 204 214 N/A INTRINSIC
low complexity region 230 247 N/A INTRINSIC
low complexity region 273 285 N/A INTRINSIC
SH3 460 515 5.19e-15 SMART
PDB:2E8M|A 516 582 3e-7 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131345
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133570
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135512
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137800
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137970
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138472
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144591
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145191
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146337
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152663
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154329
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163675
Predicted Effect probably benign
Transcript: ENSMUST00000167387
SMART Domains Protein: ENSMUSP00000127020
Gene: ENSMUSG00000004032

DomainStartEndE-ValueType
Pfam:GST_C 41 129 2.1e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167523
SMART Domains Protein: ENSMUSP00000127840
Gene: ENSMUSG00000004032

DomainStartEndE-ValueType
Pfam:GST_N 6 67 6.2e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169365
SMART Domains Protein: ENSMUSP00000128306
Gene: ENSMUSG00000004032

DomainStartEndE-ValueType
Pfam:GST_C 41 129 2.1e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170058
SMART Domains Protein: ENSMUSP00000125913
Gene: ENSMUSG00000004032

DomainStartEndE-ValueType
Pfam:GST_N 6 55 3.4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172247
SMART Domains Protein: ENSMUSP00000129426
Gene: ENSMUSG00000004032

DomainStartEndE-ValueType
Pfam:GST_N 6 85 2.1e-21 PFAM
Pfam:GST_C 107 193 2.2e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198085
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is related to epidermal growth factor receptor pathway substrate 8 (EPS8), a substrate for the epidermal growth factor receptor. The function of this protein is unknown. Alternatively spliced transcript variants encoding different isoforms exist. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T C 10: 80,015,442 V2163A probably benign Het
Abcg3 G A 5: 104,968,170 A266V probably damaging Het
Ago1 T C 4: 126,448,794 I519V probably benign Het
Arhgap4 G A X: 73,906,817 R43W probably damaging Het
Aurkb T A 11: 69,048,815 L213I possibly damaging Het
Bod1l T A 5: 41,817,002 Q2323L probably benign Het
Ccdc17 C T 4: 116,596,869 T28I probably benign Het
Ccdc39 T C 3: 33,816,937 E630G probably damaging Het
Cnih4 A G 1: 181,153,735 I24V probably benign Het
Ctse C A 1: 131,664,374 T146K possibly damaging Het
Ctsr A G 13: 61,161,264 F226L probably damaging Het
Cyp2a22 T C 7: 26,939,215 N49D probably benign Het
Defb23 C T 2: 152,459,284 A123T probably benign Het
Dtx2 C A 5: 136,010,295 D69E probably damaging Het
Eps8l1 T C 7: 4,470,035 V91A probably benign Het
Esyt3 A G 9: 99,318,207 S645P probably benign Het
Fam161a T A 11: 23,028,869 M472K unknown Het
Fam196b A G 11: 34,404,349 Y473C probably damaging Het
Fam26e A T 10: 34,095,993 C149S probably damaging Het
Glp2r A G 11: 67,709,739 V428A probably benign Het
Gnl1 G A 17: 35,981,600 V191I probably benign Het
Hfm1 T C 5: 106,911,453 I234M probably benign Het
Hlx T C 1: 184,730,865 T197A probably benign Het
Hs3st2 T C 7: 121,393,082 L85P probably damaging Het
Igsf9 T C 1: 172,494,771 V511A possibly damaging Het
Kcnma1 A T 14: 24,003,771 C54S possibly damaging Het
Klhdc4 A G 8: 121,804,993 V181A probably benign Het
Ldb3 T C 14: 34,577,029 M213V probably null Het
Mertk C A 2: 128,771,401 Q446K probably benign Het
Ndufs1 A G 1: 63,147,158 V46A probably benign Het
Neurod4 A G 10: 130,271,402 M1T probably null Het
Nlrc5 T A 8: 94,475,757 C162S probably benign Het
Pald1 A G 10: 61,323,297 I785T possibly damaging Het
Pcmt1 T C 10: 7,638,190 I224M possibly damaging Het
Pisd C T 5: 32,737,363 R533H probably benign Het
Plcxd3 C A 15: 4,517,194 Q227K probably benign Het
Polr1b A T 2: 129,105,351 K199* probably null Het
Ppp1r10 T C 17: 35,929,489 V557A probably damaging Het
Ralgapa2 A G 2: 146,449,273 Y248H probably damaging Het
Rsrp1 T C 4: 134,924,020 S32P unknown Het
Setdb2 T G 14: 59,423,365 S110R possibly damaging Het
Srcin1 A G 11: 97,548,951 C152R probably benign Het
Syk A G 13: 52,611,047 N70S probably benign Het
Tlr4 T A 4: 66,833,980 D59E probably damaging Het
Tm9sf4 T A 2: 153,182,458 I67N probably benign Het
Trim30b T A 7: 104,357,577 Y24F probably damaging Het
Tsga13 A G 6: 30,900,016 S189P probably damaging Het
Tspan33 A G 6: 29,717,233 D210G probably benign Het
Use1 G T 8: 71,369,687 R278L probably damaging Het
Wwc1 T C 11: 35,876,596 N403D probably damaging Het
Zfp263 C T 16: 3,746,454 P203S probably benign Het
Other mutations in Eps8l3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01627:Eps8l3 APN 3 107881171 missense probably damaging 0.97
IGL01694:Eps8l3 APN 3 107892308 missense probably damaging 1.00
IGL02748:Eps8l3 APN 3 107879368 intron probably benign
PIT1430001:Eps8l3 UTSW 3 107884867 missense probably damaging 1.00
R0060:Eps8l3 UTSW 3 107879541 missense probably damaging 0.98
R0060:Eps8l3 UTSW 3 107879541 missense probably damaging 0.98
R0517:Eps8l3 UTSW 3 107883460 missense probably benign
R0555:Eps8l3 UTSW 3 107892345 missense probably benign
R0585:Eps8l3 UTSW 3 107881197 missense probably damaging 0.99
R0646:Eps8l3 UTSW 3 107884810 missense probably damaging 1.00
R0741:Eps8l3 UTSW 3 107882825 missense probably benign
R1682:Eps8l3 UTSW 3 107891306 missense possibly damaging 0.82
R1844:Eps8l3 UTSW 3 107879586 missense possibly damaging 0.95
R1900:Eps8l3 UTSW 3 107890952 missense probably benign 0.16
R1937:Eps8l3 UTSW 3 107884392 missense probably benign 0.02
R2010:Eps8l3 UTSW 3 107879372 start codon destroyed probably null 1.00
R2973:Eps8l3 UTSW 3 107891328 missense probably damaging 1.00
R4369:Eps8l3 UTSW 3 107891014 missense possibly damaging 0.95
R4803:Eps8l3 UTSW 3 107891009 missense probably damaging 1.00
R4926:Eps8l3 UTSW 3 107890688 splice site probably benign
R5420:Eps8l3 UTSW 3 107883985 nonsense probably null
R5580:Eps8l3 UTSW 3 107881603 missense probably damaging 1.00
R5593:Eps8l3 UTSW 3 107891188 unclassified probably benign
R5699:Eps8l3 UTSW 3 107879579 missense probably benign 0.06
R5972:Eps8l3 UTSW 3 107884447 splice site probably null
R6250:Eps8l3 UTSW 3 107890465 missense probably benign 0.01
R7097:Eps8l3 UTSW 3 107884485 intron probably null
Z1177:Eps8l3 UTSW 3 107881666 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGGAACTGACTGTGGCACAG -3'
(R):5'- TTCTGACTTCTGACTTAGGACTCAGG -3'

Sequencing Primer
(F):5'- TGAGGCCCATGCTTGAAG -3'
(R):5'- CTGACTTAGGACTCAGGGCTTC -3'
Posted On2017-01-03