Incidental Mutation 'R5705:Ccdc17'
ID451909
Institutional Source Beutler Lab
Gene Symbol Ccdc17
Ensembl Gene ENSMUSG00000034035
Gene Namecoiled-coil domain containing 17
Synonyms1100001F07Rik
MMRRC Submission 043330-MU
Accession Numbers

Genbank: NM_001037916

Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R5705 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location116596654-116600266 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 116596869 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 28 (T28I)
Ref Sequence ENSEMBL: ENSMUSP00000059848 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030456] [ENSMUST00000030457] [ENSMUST00000030460] [ENSMUST00000051869] [ENSMUST00000081182] [ENSMUST00000106475]
Predicted Effect probably benign
Transcript: ENSMUST00000030456
SMART Domains Protein: ENSMUSP00000030456
Gene: ENSMUSG00000028693

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
TPR 43 76 8.51e0 SMART
low complexity region 111 126 N/A INTRINSIC
low complexity region 152 162 N/A INTRINSIC
low complexity region 336 352 N/A INTRINSIC
low complexity region 455 478 N/A INTRINSIC
low complexity region 492 503 N/A INTRINSIC
TPR 528 561 3.05e0 SMART
TPR 570 603 2.38e-2 SMART
low complexity region 620 640 N/A INTRINSIC
low complexity region 703 715 N/A INTRINSIC
low complexity region 742 759 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000030457
SMART Domains Protein: ENSMUSP00000030457
Gene: ENSMUSG00000028693

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
TPR 43 76 8.51e0 SMART
low complexity region 111 126 N/A INTRINSIC
low complexity region 133 153 N/A INTRINSIC
low complexity region 167 178 N/A INTRINSIC
TPR 203 236 3.05e0 SMART
TPR 245 278 2.38e-2 SMART
low complexity region 295 315 N/A INTRINSIC
low complexity region 378 390 N/A INTRINSIC
low complexity region 417 434 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000030460
SMART Domains Protein: ENSMUSP00000030460
Gene: ENSMUSG00000034042

DomainStartEndE-ValueType
low complexity region 204 219 N/A INTRINSIC
low complexity region 237 251 N/A INTRINSIC
low complexity region 289 320 N/A INTRINSIC
Pfam:Vasculin 376 470 5.1e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000051869
AA Change: T28I

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000059848
Gene: ENSMUSG00000034035
AA Change: T28I

DomainStartEndE-ValueType
coiled coil region 97 161 N/A INTRINSIC
coiled coil region 219 270 N/A INTRINSIC
low complexity region 415 427 N/A INTRINSIC
low complexity region 523 537 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000081182
SMART Domains Protein: ENSMUSP00000079946
Gene: ENSMUSG00000028693

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
TPR 43 76 6.2e-2 SMART
low complexity region 84 99 N/A INTRINSIC
low complexity region 106 126 N/A INTRINSIC
low complexity region 140 151 N/A INTRINSIC
TPR 176 209 1.4e-2 SMART
TPR 218 251 1.1e-4 SMART
low complexity region 268 288 N/A INTRINSIC
low complexity region 351 363 N/A INTRINSIC
low complexity region 390 407 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106475
SMART Domains Protein: ENSMUSP00000102083
Gene: ENSMUSG00000034042

DomainStartEndE-ValueType
low complexity region 204 219 N/A INTRINSIC
low complexity region 237 251 N/A INTRINSIC
low complexity region 289 320 N/A INTRINSIC
Pfam:Vasculin 377 470 1.3e-44 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000121907
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142815
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146777
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148260
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151441
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI

All alleles(2) : Targeted, knock-out(1) Gene trapped(1)

Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T C 10: 80,015,442 V2163A probably benign Het
Abcg3 G A 5: 104,968,170 A266V probably damaging Het
Ago1 T C 4: 126,448,794 I519V probably benign Het
Arhgap4 G A X: 73,906,817 R43W probably damaging Het
Aurkb T A 11: 69,048,815 L213I possibly damaging Het
Bod1l T A 5: 41,817,002 Q2323L probably benign Het
Ccdc39 T C 3: 33,816,937 E630G probably damaging Het
Cnih4 A G 1: 181,153,735 I24V probably benign Het
Ctse C A 1: 131,664,374 T146K possibly damaging Het
Ctsr A G 13: 61,161,264 F226L probably damaging Het
Cyp2a22 T C 7: 26,939,215 N49D probably benign Het
Defb23 C T 2: 152,459,284 A123T probably benign Het
Dtx2 C A 5: 136,010,295 D69E probably damaging Het
Eps8l1 T C 7: 4,470,035 V91A probably benign Het
Eps8l3 C A 3: 107,891,264 Q489K probably benign Het
Esyt3 A G 9: 99,318,207 S645P probably benign Het
Fam161a T A 11: 23,028,869 M472K unknown Het
Fam196b A G 11: 34,404,349 Y473C probably damaging Het
Fam26e A T 10: 34,095,993 C149S probably damaging Het
Glp2r A G 11: 67,709,739 V428A probably benign Het
Gnl1 G A 17: 35,981,600 V191I probably benign Het
Hfm1 T C 5: 106,911,453 I234M probably benign Het
Hlx T C 1: 184,730,865 T197A probably benign Het
Hs3st2 T C 7: 121,393,082 L85P probably damaging Het
Igsf9 T C 1: 172,494,771 V511A possibly damaging Het
Kcnma1 A T 14: 24,003,771 C54S possibly damaging Het
Klhdc4 A G 8: 121,804,993 V181A probably benign Het
Ldb3 T C 14: 34,577,029 M213V probably null Het
Mertk C A 2: 128,771,401 Q446K probably benign Het
Ndufs1 A G 1: 63,147,158 V46A probably benign Het
Neurod4 A G 10: 130,271,402 M1T probably null Het
Nlrc5 T A 8: 94,475,757 C162S probably benign Het
Pald1 A G 10: 61,323,297 I785T possibly damaging Het
Pcmt1 T C 10: 7,638,190 I224M possibly damaging Het
Pisd C T 5: 32,737,363 R533H probably benign Het
Plcxd3 C A 15: 4,517,194 Q227K probably benign Het
Polr1b A T 2: 129,105,351 K199* probably null Het
Ppp1r10 T C 17: 35,929,489 V557A probably damaging Het
Ralgapa2 A G 2: 146,449,273 Y248H probably damaging Het
Rsrp1 T C 4: 134,924,020 S32P unknown Het
Setdb2 T G 14: 59,423,365 S110R possibly damaging Het
Srcin1 A G 11: 97,548,951 C152R probably benign Het
Syk A G 13: 52,611,047 N70S probably benign Het
Tlr4 T A 4: 66,833,980 D59E probably damaging Het
Tm9sf4 T A 2: 153,182,458 I67N probably benign Het
Trim30b T A 7: 104,357,577 Y24F probably damaging Het
Tsga13 A G 6: 30,900,016 S189P probably damaging Het
Tspan33 A G 6: 29,717,233 D210G probably benign Het
Use1 G T 8: 71,369,687 R278L probably damaging Het
Wwc1 T C 11: 35,876,596 N403D probably damaging Het
Zfp263 C T 16: 3,746,454 P203S probably benign Het
Other mutations in Ccdc17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01661:Ccdc17 APN 4 116597866 missense probably benign
IGL03106:Ccdc17 APN 4 116596836 unclassified probably null
IGL03169:Ccdc17 APN 4 116597760 missense probably damaging 1.00
IGL03288:Ccdc17 APN 4 116599429 missense probably damaging 1.00
dandy UTSW 4 116599592 missense probably damaging 1.00
Dondi UTSW 4 116598548 missense probably damaging 1.00
G5030:Ccdc17 UTSW 4 116598502 missense probably benign 0.42
R0628:Ccdc17 UTSW 4 116598548 missense probably damaging 1.00
R1033:Ccdc17 UTSW 4 116596880 nonsense probably null
R2041:Ccdc17 UTSW 4 116599592 missense probably damaging 1.00
R3107:Ccdc17 UTSW 4 116598267 missense probably benign 0.02
R3122:Ccdc17 UTSW 4 116599552 unclassified probably benign
R4498:Ccdc17 UTSW 4 116597241 unclassified probably benign
R6052:Ccdc17 UTSW 4 116599948 unclassified probably null
R6083:Ccdc17 UTSW 4 116596926 missense possibly damaging 0.89
R6925:Ccdc17 UTSW 4 116598210 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGCGATTTAGCAGACTTGG -3'
(R):5'- TGTGCTGGCTTCCTGATCAC -3'

Sequencing Primer
(F):5'- CGATTTAGCAGACTTGGTCTATTC -3'
(R):5'- GGCTTCCTGATCACGGCTC -3'
Posted On2017-01-03