Mutagenetix > Incidental Mutation

Incidental Mutation 'R0551:Adcy2'

45191

Institutional Source

Beutler Lab

Gene Symbol

Adcy2

Ensembl Gene

ENSMUSG00000021536

Gene Name

adenylate cyclase 2

Synonyms

MMRRC Submission

038743-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0551 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

68620043-68999541 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 68796539 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Asparagine at position 241 (K241N)

Ref Sequence

ENSEMBL: ENSMUSP00000022013 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022013]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000022013
AA Change: K241N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000022013
Gene: ENSMUSG00000021536
AA Change: K241N

Domain	Start	End	E-Value	Type
low complexity region	16	29	N/A	INTRINSIC
low complexity region	60	74	N/A	INTRINSIC
CYCc	239	447	6.62e-66	SMART
Pfam:DUF1053	499	604	2.6e-41	PFAM
transmembrane domain	631	653	N/A	INTRINSIC
low complexity region	659	673	N/A	INTRINSIC
transmembrane domain	684	706	N/A	INTRINSIC
transmembrane domain	738	760	N/A	INTRINSIC
transmembrane domain	767	789	N/A	INTRINSIC
transmembrane domain	809	826	N/A	INTRINSIC
CYCc	851	1065	5.49e-40	SMART

Meta Mutation Damage Score

0.0773

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.1%
20x: 95.1%

Validation Efficiency

99% (77/78)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the family of adenylate cyclases, which are membrane-associated enzymes that catalyze the formation of the secondary messenger cyclic adenosine monophosphate (cAMP). This enzyme is insensitive to Ca(2+)/calmodulin, and is stimulated by the G protein beta and gamma subunit complex. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3425401B19Rik	T	A	14: 32,662,641	T456S	probably benign	Het
5830473C10Rik	C	T	5: 90,572,719	P250S	probably damaging	Het
Acmsd	A	T	1: 127,766,333	K333N	probably benign	Het
Aebp1	A	G	11: 5,867,955	I77V	probably benign	Het
Ankrd35	A	G	3: 96,683,960	T521A	probably benign	Het
Arap2	C	T	5: 62,641,323		probably null	Het
Arfgap3	A	T	15: 83,343,137	C25S	probably damaging	Het
Arhgap20	T	A	9: 51,825,825		probably benign	Het
Arhgap39	C	T	15: 76,734,886	D833N	probably damaging	Het
Auts2	T	C	5: 131,440,469	E446G	possibly damaging	Het
Brwd1	C	T	16: 96,035,974	R886H	probably damaging	Het
Carm1	G	A	9: 21,580,491		probably null	Het
Cdc5l	G	A	17: 45,415,684	R321W	probably damaging	Het
Cfap54	A	T	10: 93,025,122	M841K	probably benign	Het
Clca4b	T	A	3: 144,928,626	T69S	probably damaging	Het
Cpox	A	G	16: 58,675,390	I357V	probably benign	Het
Diaph3	C	A	14: 86,910,100	V711L	probably benign	Het
Fabp3-ps1	T	C	10: 86,732,040		probably benign	Het
Fam120b	A	T	17: 15,431,643		probably benign	Het
Fcho1	A	G	8: 71,712,174	S488P	probably benign	Het
Flcn	A	G	11: 59,795,748		probably null	Het
Flt3l	A	G	7: 45,132,266	W234R	probably damaging	Het
Fzd7	G	T	1: 59,483,284	V109L	probably damaging	Het
G3bp1	A	G	11: 55,489,143	N101S	probably benign	Het
Gadd45g	A	G	13: 51,847,927	E143G	probably damaging	Het
Ganab	T	G	19: 8,907,280	I149S	probably benign	Het
Garnl3	A	G	2: 33,016,738	S413P	probably damaging	Het
Glis1	C	T	4: 107,568,119		probably null	Het
Gm11563	A	G	11: 99,658,713	S72P	unknown	Het
Gpd1	T	G	15: 99,720,629	I188S	possibly damaging	Het
Gria2	A	G	3: 80,732,026		probably benign	Het
H2afy2	A	G	10: 61,741,166	S308P	probably damaging	Het
Hpcal4	G	T	4: 123,189,055	A65S	possibly damaging	Het
Igsf10	G	A	3: 59,328,668	T1364I	probably benign	Het
Kdm4a	T	C	4: 118,138,231	*1065W	probably null	Het
Klkb1	A	G	8: 45,277,966		probably null	Het
Lipo3	T	C	19: 33,580,551	D147G	probably damaging	Het
Lrp1	A	G	10: 127,571,958	S1821P	probably benign	Het
Manba	T	C	3: 135,517,973	I207T	probably damaging	Het
Mark3	T	A	12: 111,633,634	S428T	probably benign	Het
Mfsd4a	G	A	1: 132,041,919	T348I	probably damaging	Het
Mfsd7a	A	G	5: 108,444,465		probably benign	Het
Mybbp1a	A	G	11: 72,448,376	M880V	probably benign	Het
N4bp2	T	A	5: 65,820,341		probably null	Het
Nrd1	T	G	4: 109,047,708	I712S	probably damaging	Het
Nup210	G	A	6: 91,021,484	R774C	possibly damaging	Het
Obscn	G	A	11: 59,107,862	R1395*	probably null	Het
Olfr1454	T	A	19: 13,064,294	D294E	probably benign	Het
Pcdh7	T	C	5: 57,721,994	Y964H	probably damaging	Het
Plin4	T	C	17: 56,106,756	T290A	probably benign	Het
Ppara	T	C	15: 85,787,105		probably benign	Het
Psg21	T	G	7: 18,652,640		probably null	Het
Ptar1	C	A	19: 23,720,340	N405K	probably benign	Het
Ralgps2	A	G	1: 156,832,663		probably null	Het
Rnf6	T	A	5: 146,211,395	N271I	possibly damaging	Het
Sis	T	C	3: 72,925,407	D1019G	possibly damaging	Het
Slc37a3	A	G	6: 39,352,754		probably benign	Het
Slc6a12	G	A	6: 121,356,918	V238I	probably damaging	Het
Sntg1	C	A	1: 8,554,736	V279L	possibly damaging	Het
Sorbs1	T	A	19: 40,311,816	E567D	probably damaging	Het
Sp110	C	A	1: 85,589,100		probably benign	Het
Ssu2	A	G	6: 112,380,554	V175A	possibly damaging	Het
Stk36	G	A	1: 74,616,621	E428K	probably benign	Het
Teddm1b	A	T	1: 153,875,344	I300F	possibly damaging	Het
Thy1	T	C	9: 44,047,348	V129A	probably damaging	Het
Tiam2	T	A	17: 3,428,954	M654K	probably damaging	Het
Tmem69	T	C	4: 116,553,273	S167G	probably benign	Het
Tmem8	C	A	17: 26,120,602	Q605K	probably damaging	Het
Tmem81	C	G	1: 132,507,829	I124M	probably damaging	Het
Tspan10	A	G	11: 120,444,418	D118G	probably damaging	Het
Tspo2	A	G	17: 48,448,813		probably benign	Het
Ttn	G	A	2: 76,908,328	Q4002*	probably null	Het
Tyro3	G	A	2: 119,816,904	R834Q	probably damaging	Het
Ugt2b1	T	C	5: 86,926,084	K139E	probably benign	Het
Vmn1r9	A	T	6: 57,071,539	I200F	probably benign	Het

Other mutations in Adcy2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00923:Adcy2	APN	13	68620796	missense	probably damaging	1.00
IGL01074:Adcy2	APN	13	68796654	missense	possibly damaging	0.93
IGL01394:Adcy2	APN	13	68982402	missense	probably damaging	1.00
IGL01820:Adcy2	APN	13	68738545	splice site	probably null
IGL02048:Adcy2	APN	13	68888067	missense	possibly damaging	0.46
IGL02378:Adcy2	APN	13	68730292	missense	probably damaging	1.00
IGL02419:Adcy2	APN	13	68982363	missense	probably benign	0.40
IGL02896:Adcy2	APN	13	68727872	missense	probably damaging	1.00
IGL02953:Adcy2	APN	13	68729328	missense	probably damaging	1.00
IGL03358:Adcy2	APN	13	68729277	missense	probably damaging	1.00
IGL03387:Adcy2	APN	13	68730367	missense	probably damaging	1.00
PIT4305001:Adcy2	UTSW	13	68678602	missense	probably benign	0.00
PIT4366001:Adcy2	UTSW	13	68709990	critical splice donor site	probably benign
R0044:Adcy2	UTSW	13	68727899	missense	possibly damaging	0.94
R0044:Adcy2	UTSW	13	68727899	missense	possibly damaging	0.94
R0083:Adcy2	UTSW	13	68651935	missense	probably damaging	0.99
R0108:Adcy2	UTSW	13	68651935	missense	probably damaging	0.99
R0269:Adcy2	UTSW	13	68678606	nonsense	probably null
R0369:Adcy2	UTSW	13	68671900	missense	probably benign	0.00
R0480:Adcy2	UTSW	13	68732112	missense	probably damaging	1.00
R0550:Adcy2	UTSW	13	68982361	missense	probably benign	0.23
R0617:Adcy2	UTSW	13	68678606	nonsense	probably null
R0634:Adcy2	UTSW	13	68727945	missense	possibly damaging	0.48
R0715:Adcy2	UTSW	13	68888042	missense	probably benign	0.08
R0723:Adcy2	UTSW	13	68999129	missense	probably damaging	1.00
R1136:Adcy2	UTSW	13	68730317	missense	probably damaging	1.00
R1271:Adcy2	UTSW	13	68642498	missense	probably damaging	1.00
R1349:Adcy2	UTSW	13	68668533	missense	probably damaging	0.98
R1372:Adcy2	UTSW	13	68668533	missense	probably damaging	0.98
R1390:Adcy2	UTSW	13	68657393	missense	possibly damaging	0.94
R1495:Adcy2	UTSW	13	68796535	missense	probably benign	0.30
R1706:Adcy2	UTSW	13	68720746	missense	probably damaging	1.00
R1839:Adcy2	UTSW	13	68689261	splice site	probably null
R2004:Adcy2	UTSW	13	68796603	missense	probably damaging	1.00
R2235:Adcy2	UTSW	13	68668492	missense	probably damaging	0.98
R2242:Adcy2	UTSW	13	68689341	missense	probably benign	0.00
R2940:Adcy2	UTSW	13	68730305	missense	probably damaging	1.00
R3624:Adcy2	UTSW	13	68642531	missense	probably damaging	0.99
R3689:Adcy2	UTSW	13	68630969	missense	probably damaging	1.00
R4685:Adcy2	UTSW	13	68727905	missense	probably benign	0.32
R4695:Adcy2	UTSW	13	68727843	missense	possibly damaging	0.67
R5213:Adcy2	UTSW	13	68620823	missense	possibly damaging	0.61
R5645:Adcy2	UTSW	13	68729202	splice site	probably null
R5687:Adcy2	UTSW	13	68620819	nonsense	probably null
R5687:Adcy2	UTSW	13	68642569	missense	probably damaging	1.00
R5833:Adcy2	UTSW	13	68738603	missense	probably benign
R5846:Adcy2	UTSW	13	68738588	missense	probably damaging	0.99
R5894:Adcy2	UTSW	13	68625852	missense	probably damaging	1.00
R6111:Adcy2	UTSW	13	68729241	missense	probably damaging	0.99
R6311:Adcy2	UTSW	13	68625792	missense	probably damaging	1.00
R6642:Adcy2	UTSW	13	68620826	missense	probably damaging	1.00
R6644:Adcy2	UTSW	13	68668552	missense	possibly damaging	0.88
R6899:Adcy2	UTSW	13	68982381	missense	probably damaging	0.99
R6917:Adcy2	UTSW	13	68620757	missense	possibly damaging	0.68
R6950:Adcy2	UTSW	13	68888065	missense	possibly damaging	0.93
R7006:Adcy2	UTSW	13	68888020	missense	probably damaging	1.00
R7186:Adcy2	UTSW	13	68668639	missense	probably damaging	1.00
R7311:Adcy2	UTSW	13	68630954	missense	probably damaging	1.00
R7348:Adcy2	UTSW	13	68734675	missense	possibly damaging	0.79
R7440:Adcy2	UTSW	13	68796667	missense	probably damaging	0.97
R7463:Adcy2	UTSW	13	68730280	missense	probably damaging	1.00
R7827:Adcy2	UTSW	13	68689281	missense	probably damaging	1.00
R7919:Adcy2	UTSW	13	68887972	missense	probably benign	0.08
R8144:Adcy2	UTSW	13	68734635	nonsense	probably null
R8256:Adcy2	UTSW	13	68620761	missense	probably damaging	1.00
R8556:Adcy2	UTSW	13	68630975	missense	possibly damaging	0.61
R9121:Adcy2	UTSW	13	68671959	missense	probably benign	0.35
R9128:Adcy2	UTSW	13	68625808	missense	probably damaging	1.00
R9255:Adcy2	UTSW	13	68888080	missense	possibly damaging	0.93
R9464:Adcy2	UTSW	13	68734657	missense	probably damaging	1.00
R9749:Adcy2	UTSW	13	68625855	missense	probably damaging	1.00
R9799:Adcy2	UTSW	13	68620842	missense	probably benign	0.03
R9799:Adcy2	UTSW	13	68657370	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAAATAGCTGCTGCCACCCTGC -3'
(R):5'- TGAGTCTAAAATCCAGGGAGGGACC -3'

Sequencing Primer
(F):5'- TGCCACCCTGCCATGAC -3'
(R):5'- AGCAAACCTATCGGGACACA -3'

Posted On

2013-06-11