Mutagenetix > Incidental Mutation

Incidental Mutation 'R0551:3425401B19Rik'

45192

Institutional Source

Beutler Lab

Gene Symbol

3425401B19Rik

Ensembl Gene

ENSMUSG00000071540

Gene Name

RIKEN cDNA 3425401B19 gene

Synonyms

MMRRC Submission

038743-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.070) question?

Stock #

R0551 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

32659119-32685293 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 32662641 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 456 (T456S)

Ref Sequence

ENSEMBL: ENSMUSP00000093741 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000096038]

AlphaFold

D3Z1D3

Predicted Effect

probably benign
Transcript: ENSMUST00000096038
AA Change: T456S

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000093741
Gene: ENSMUSG00000071540
AA Change: T456S

Domain	Start	End	E-Value	Type
low complexity region	135	145	N/A	INTRINSIC
low complexity region	162	175	N/A	INTRINSIC
low complexity region	386	399	N/A	INTRINSIC
low complexity region	587	602	N/A	INTRINSIC
low complexity region	605	624	N/A	INTRINSIC
low complexity region	728	744	N/A	INTRINSIC
low complexity region	1002	1015	N/A	INTRINSIC
low complexity region	1086	1097	N/A	INTRINSIC
low complexity region	1147	1158	N/A	INTRINSIC
low complexity region	1161	1176	N/A	INTRINSIC
Pfam:DUF4585	1251	1322	6.5e-30	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.1%
20x: 95.1%

Validation Efficiency

99% (77/78)

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5830473C10Rik	C	T	5: 90,572,719	P250S	probably damaging	Het
Acmsd	A	T	1: 127,766,333	K333N	probably benign	Het
Adcy2	T	A	13: 68,796,539	K241N	probably damaging	Het
Aebp1	A	G	11: 5,867,955	I77V	probably benign	Het
Ankrd35	A	G	3: 96,683,960	T521A	probably benign	Het
Arap2	C	T	5: 62,641,323		probably null	Het
Arfgap3	A	T	15: 83,343,137	C25S	probably damaging	Het
Arhgap20	T	A	9: 51,825,825		probably benign	Het
Arhgap39	C	T	15: 76,734,886	D833N	probably damaging	Het
Auts2	T	C	5: 131,440,469	E446G	possibly damaging	Het
Brwd1	C	T	16: 96,035,974	R886H	probably damaging	Het
Carm1	G	A	9: 21,580,491		probably null	Het
Cdc5l	G	A	17: 45,415,684	R321W	probably damaging	Het
Cfap54	A	T	10: 93,025,122	M841K	probably benign	Het
Clca4b	T	A	3: 144,928,626	T69S	probably damaging	Het
Cpox	A	G	16: 58,675,390	I357V	probably benign	Het
Diaph3	C	A	14: 86,910,100	V711L	probably benign	Het
Fabp3-ps1	T	C	10: 86,732,040		probably benign	Het
Fam120b	A	T	17: 15,431,643		probably benign	Het
Fcho1	A	G	8: 71,712,174	S488P	probably benign	Het
Flcn	A	G	11: 59,795,748		probably null	Het
Flt3l	A	G	7: 45,132,266	W234R	probably damaging	Het
Fzd7	G	T	1: 59,483,284	V109L	probably damaging	Het
G3bp1	A	G	11: 55,489,143	N101S	probably benign	Het
Gadd45g	A	G	13: 51,847,927	E143G	probably damaging	Het
Ganab	T	G	19: 8,907,280	I149S	probably benign	Het
Garnl3	A	G	2: 33,016,738	S413P	probably damaging	Het
Glis1	C	T	4: 107,568,119		probably null	Het
Gm11563	A	G	11: 99,658,713	S72P	unknown	Het
Gpd1	T	G	15: 99,720,629	I188S	possibly damaging	Het
Gria2	A	G	3: 80,732,026		probably benign	Het
H2afy2	A	G	10: 61,741,166	S308P	probably damaging	Het
Hpcal4	G	T	4: 123,189,055	A65S	possibly damaging	Het
Igsf10	G	A	3: 59,328,668	T1364I	probably benign	Het
Kdm4a	T	C	4: 118,138,231	*1065W	probably null	Het
Klkb1	A	G	8: 45,277,966		probably null	Het
Lipo3	T	C	19: 33,580,551	D147G	probably damaging	Het
Lrp1	A	G	10: 127,571,958	S1821P	probably benign	Het
Manba	T	C	3: 135,517,973	I207T	probably damaging	Het
Mark3	T	A	12: 111,633,634	S428T	probably benign	Het
Mfsd4a	G	A	1: 132,041,919	T348I	probably damaging	Het
Mfsd7a	A	G	5: 108,444,465		probably benign	Het
Mybbp1a	A	G	11: 72,448,376	M880V	probably benign	Het
N4bp2	T	A	5: 65,820,341		probably null	Het
Nrd1	T	G	4: 109,047,708	I712S	probably damaging	Het
Nup210	G	A	6: 91,021,484	R774C	possibly damaging	Het
Obscn	G	A	11: 59,107,862	R1395*	probably null	Het
Olfr1454	T	A	19: 13,064,294	D294E	probably benign	Het
Pcdh7	T	C	5: 57,721,994	Y964H	probably damaging	Het
Plin4	T	C	17: 56,106,756	T290A	probably benign	Het
Ppara	T	C	15: 85,787,105		probably benign	Het
Psg21	T	G	7: 18,652,640		probably null	Het
Ptar1	C	A	19: 23,720,340	N405K	probably benign	Het
Ralgps2	A	G	1: 156,832,663		probably null	Het
Rnf6	T	A	5: 146,211,395	N271I	possibly damaging	Het
Sis	T	C	3: 72,925,407	D1019G	possibly damaging	Het
Slc37a3	A	G	6: 39,352,754		probably benign	Het
Slc6a12	G	A	6: 121,356,918	V238I	probably damaging	Het
Sntg1	C	A	1: 8,554,736	V279L	possibly damaging	Het
Sorbs1	T	A	19: 40,311,816	E567D	probably damaging	Het
Sp110	C	A	1: 85,589,100		probably benign	Het
Ssu2	A	G	6: 112,380,554	V175A	possibly damaging	Het
Stk36	G	A	1: 74,616,621	E428K	probably benign	Het
Teddm1b	A	T	1: 153,875,344	I300F	possibly damaging	Het
Thy1	T	C	9: 44,047,348	V129A	probably damaging	Het
Tiam2	T	A	17: 3,428,954	M654K	probably damaging	Het
Tmem69	T	C	4: 116,553,273	S167G	probably benign	Het
Tmem8	C	A	17: 26,120,602	Q605K	probably damaging	Het
Tmem81	C	G	1: 132,507,829	I124M	probably damaging	Het
Tspan10	A	G	11: 120,444,418	D118G	probably damaging	Het
Tspo2	A	G	17: 48,448,813		probably benign	Het
Ttn	G	A	2: 76,908,328	Q4002*	probably null	Het
Tyro3	G	A	2: 119,816,904	R834Q	probably damaging	Het
Ugt2b1	T	C	5: 86,926,084	K139E	probably benign	Het
Vmn1r9	A	T	6: 57,071,539	I200F	probably benign	Het

Other mutations in 3425401B19Rik

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00839:3425401B19Rik	APN	14	32660916	missense	probably benign	0.18
IGL00844:3425401B19Rik	APN	14	32662999	nonsense	probably null
IGL01292:3425401B19Rik	APN	14	32660874	missense	probably benign	0.18
IGL01295:3425401B19Rik	APN	14	32661936	missense	possibly damaging	0.53
IGL01457:3425401B19Rik	APN	14	32660951	missense	probably benign
IGL01470:3425401B19Rik	APN	14	32660457	missense	possibly damaging	0.53
IGL01612:3425401B19Rik	APN	14	32660031	missense	possibly damaging	0.53
IGL01974:3425401B19Rik	APN	14	32659805	missense	possibly damaging	0.85
IGL02095:3425401B19Rik	APN	14	32661626	missense	probably benign	0.33
IGL02138:3425401B19Rik	APN	14	32662715	missense	possibly damaging	0.83
IGL02178:3425401B19Rik	APN	14	32662461	missense	possibly damaging	0.83
IGL02245:3425401B19Rik	APN	14	32659815	missense	probably benign	0.03
IGL02529:3425401B19Rik	APN	14	32661233	missense	probably benign
IGL03401:3425401B19Rik	APN	14	32662266	nonsense	probably null
PIT4515001:3425401B19Rik	UTSW	14	32661111	nonsense	probably null
R0233:3425401B19Rik	UTSW	14	32663373	missense	probably benign
R0233:3425401B19Rik	UTSW	14	32663373	missense	probably benign
R0320:3425401B19Rik	UTSW	14	32662614	missense	probably benign	0.19
R0519:3425401B19Rik	UTSW	14	32662962	missense	possibly damaging	0.92
R0759:3425401B19Rik	UTSW	14	32662497	missense	possibly damaging	0.93
R0831:3425401B19Rik	UTSW	14	32662271	missense	probably benign	0.01
R1124:3425401B19Rik	UTSW	14	32662082	missense	possibly damaging	0.53
R1346:3425401B19Rik	UTSW	14	32660814	missense	probably benign	0.07
R1997:3425401B19Rik	UTSW	14	32660048	missense	possibly damaging	0.71
R2055:3425401B19Rik	UTSW	14	32662551	missense	probably benign
R2212:3425401B19Rik	UTSW	14	32661602	missense	probably benign	0.33
R2416:3425401B19Rik	UTSW	14	32663834	missense	probably benign	0.04
R2441:3425401B19Rik	UTSW	14	32663492	missense	possibly damaging	0.53
R2513:3425401B19Rik	UTSW	14	32661852	missense	possibly damaging	0.53
R3414:3425401B19Rik	UTSW	14	32661602	missense	probably benign	0.33
R3800:3425401B19Rik	UTSW	14	32663068	missense	possibly damaging	0.83
R3809:3425401B19Rik	UTSW	14	32663693	missense	possibly damaging	0.96
R4166:3425401B19Rik	UTSW	14	32660955	missense	possibly damaging	0.53
R4581:3425401B19Rik	UTSW	14	32661871	missense	possibly damaging	0.73
R4721:3425401B19Rik	UTSW	14	32663150	missense	probably benign	0.01
R4769:3425401B19Rik	UTSW	14	32660217	missense	probably benign	0.32
R4809:3425401B19Rik	UTSW	14	32662631	missense	probably benign	0.19
R4919:3425401B19Rik	UTSW	14	32663288	missense	possibly damaging	0.85
R4925:3425401B19Rik	UTSW	14	32663180	missense	possibly damaging	0.86
R4972:3425401B19Rik	UTSW	14	32661404	missense	possibly damaging	0.73
R5068:3425401B19Rik	UTSW	14	32661792	missense	possibly damaging	0.73
R5069:3425401B19Rik	UTSW	14	32661792	missense	possibly damaging	0.73
R5070:3425401B19Rik	UTSW	14	32661792	missense	possibly damaging	0.73
R5258:3425401B19Rik	UTSW	14	32663309	missense	probably damaging	0.98
R5435:3425401B19Rik	UTSW	14	32661456	missense	probably benign	0.18
R5549:3425401B19Rik	UTSW	14	32663036	missense	possibly damaging	0.68
R5678:3425401B19Rik	UTSW	14	32662053	missense	probably damaging	0.97
R5680:3425401B19Rik	UTSW	14	32662053	missense	probably damaging	0.97
R5872:3425401B19Rik	UTSW	14	32660352	missense	possibly damaging	0.73
R5896:3425401B19Rik	UTSW	14	32661675	nonsense	probably null
R5940:3425401B19Rik	UTSW	14	32662688	missense	possibly damaging	0.91
R6044:3425401B19Rik	UTSW	14	32660657	missense	possibly damaging	0.53
R6136:3425401B19Rik	UTSW	14	32662282	missense	possibly damaging	0.70
R6277:3425401B19Rik	UTSW	14	32663694	missense	possibly damaging	0.86
R6385:3425401B19Rik	UTSW	14	32661279	missense	probably benign	0.01
R6728:3425401B19Rik	UTSW	14	32662688	missense	possibly damaging	0.91
R6984:3425401B19Rik	UTSW	14	32661980	missense	probably benign	0.00
R7047:3425401B19Rik	UTSW	14	32660174	missense	possibly damaging	0.89
R7249:3425401B19Rik	UTSW	14	32663314	missense	possibly damaging	0.73
R7493:3425401B19Rik	UTSW	14	32663300	missense	possibly damaging	0.96
R7575:3425401B19Rik	UTSW	14	32662632	missense	probably benign	0.03
R7742:3425401B19Rik	UTSW	14	32662757	missense	possibly damaging	0.68
R7747:3425401B19Rik	UTSW	14	32663069	missense	possibly damaging	0.83
R7784:3425401B19Rik	UTSW	14	32659840	missense	probably benign	0.00
R8098:3425401B19Rik	UTSW	14	32662661	missense	probably damaging	0.99
R8111:3425401B19Rik	UTSW	14	32660309	nonsense	probably null
R8171:3425401B19Rik	UTSW	14	32662025	missense	probably benign
R8276:3425401B19Rik	UTSW	14	32663928	missense	probably damaging	0.97
R8330:3425401B19Rik	UTSW	14	32659793	missense	probably damaging	0.98
R8422:3425401B19Rik	UTSW	14	32662297	missense	possibly damaging	0.84
R8464:3425401B19Rik	UTSW	14	32659977	missense	possibly damaging	0.53
R8880:3425401B19Rik	UTSW	14	32660880	missense	probably benign	0.33
R8898:3425401B19Rik	UTSW	14	32661044	nonsense	probably null
R8911:3425401B19Rik	UTSW	14	32661669	missense	possibly damaging	0.53
R8934:3425401B19Rik	UTSW	14	32660657	missense	possibly damaging	0.53
R9094:3425401B19Rik	UTSW	14	32660657	missense	possibly damaging	0.53
R9399:3425401B19Rik	UTSW	14	32662658	missense	probably damaging	0.98
R9435:3425401B19Rik	UTSW	14	32660605	missense	probably benign	0.08
R9485:3425401B19Rik	UTSW	14	32661443	missense	possibly damaging	0.85
R9766:3425401B19Rik	UTSW	14	32663831	missense	probably benign	0.00
X0025:3425401B19Rik	UTSW	14	32662469	missense	probably damaging	0.98
Z1177:3425401B19Rik	UTSW	14	32659808	missense	possibly damaging	0.86
Z1177:3425401B19Rik	UTSW	14	32661398	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TGCTCAGAGGTTCTTGCTTGCTATC -3'
(R):5'- TGCTTTGGAAGACAAGAAACAGCCC -3'

Sequencing Primer
(F):5'- GTACTCTTGACACGTTTCCGAAC -3'
(R):5'- GCCCAATAGGAGAGGTCTACC -3'

Posted On

2013-06-11