Incidental Mutation 'R5705:Cyp2a22'
ID451921
Institutional Source Beutler Lab
Gene Symbol Cyp2a22
Ensembl Gene ENSMUSG00000091867
Gene Namecytochrome P450, family 2, subfamily a, polypeptide 22
SynonymsEG233005
MMRRC Submission 043330-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R5705 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location26931631-26939384 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 26939215 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 49 (N49D)
Ref Sequence ENSEMBL: ENSMUSP00000128030 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170227]
Predicted Effect probably benign
Transcript: ENSMUST00000170227
AA Change: N49D

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000128030
Gene: ENSMUSG00000091867
AA Change: N49D

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:p450 33 489 7.4e-148 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206638
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206957
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T C 10: 80,015,442 V2163A probably benign Het
Abcg3 G A 5: 104,968,170 A266V probably damaging Het
Ago1 T C 4: 126,448,794 I519V probably benign Het
Arhgap4 G A X: 73,906,817 R43W probably damaging Het
Aurkb T A 11: 69,048,815 L213I possibly damaging Het
Bod1l T A 5: 41,817,002 Q2323L probably benign Het
Ccdc17 C T 4: 116,596,869 T28I probably benign Het
Ccdc39 T C 3: 33,816,937 E630G probably damaging Het
Cnih4 A G 1: 181,153,735 I24V probably benign Het
Ctse C A 1: 131,664,374 T146K possibly damaging Het
Ctsr A G 13: 61,161,264 F226L probably damaging Het
Defb23 C T 2: 152,459,284 A123T probably benign Het
Dtx2 C A 5: 136,010,295 D69E probably damaging Het
Eps8l1 T C 7: 4,470,035 V91A probably benign Het
Eps8l3 C A 3: 107,891,264 Q489K probably benign Het
Esyt3 A G 9: 99,318,207 S645P probably benign Het
Fam161a T A 11: 23,028,869 M472K unknown Het
Fam196b A G 11: 34,404,349 Y473C probably damaging Het
Fam26e A T 10: 34,095,993 C149S probably damaging Het
Glp2r A G 11: 67,709,739 V428A probably benign Het
Gnl1 G A 17: 35,981,600 V191I probably benign Het
Hfm1 T C 5: 106,911,453 I234M probably benign Het
Hlx T C 1: 184,730,865 T197A probably benign Het
Hs3st2 T C 7: 121,393,082 L85P probably damaging Het
Igsf9 T C 1: 172,494,771 V511A possibly damaging Het
Kcnma1 A T 14: 24,003,771 C54S possibly damaging Het
Klhdc4 A G 8: 121,804,993 V181A probably benign Het
Ldb3 T C 14: 34,577,029 M213V probably null Het
Mertk C A 2: 128,771,401 Q446K probably benign Het
Ndufs1 A G 1: 63,147,158 V46A probably benign Het
Neurod4 A G 10: 130,271,402 M1T probably null Het
Nlrc5 T A 8: 94,475,757 C162S probably benign Het
Pald1 A G 10: 61,323,297 I785T possibly damaging Het
Pcmt1 T C 10: 7,638,190 I224M possibly damaging Het
Pisd C T 5: 32,737,363 R533H probably benign Het
Plcxd3 C A 15: 4,517,194 Q227K probably benign Het
Polr1b A T 2: 129,105,351 K199* probably null Het
Ppp1r10 T C 17: 35,929,489 V557A probably damaging Het
Ralgapa2 A G 2: 146,449,273 Y248H probably damaging Het
Rsrp1 T C 4: 134,924,020 S32P unknown Het
Setdb2 T G 14: 59,423,365 S110R possibly damaging Het
Srcin1 A G 11: 97,548,951 C152R probably benign Het
Syk A G 13: 52,611,047 N70S probably benign Het
Tlr4 T A 4: 66,833,980 D59E probably damaging Het
Tm9sf4 T A 2: 153,182,458 I67N probably benign Het
Trim30b T A 7: 104,357,577 Y24F probably damaging Het
Tsga13 A G 6: 30,900,016 S189P probably damaging Het
Tspan33 A G 6: 29,717,233 D210G probably benign Het
Use1 G T 8: 71,369,687 R278L probably damaging Het
Wwc1 T C 11: 35,876,596 N403D probably damaging Het
Zfp263 C T 16: 3,746,454 P203S probably benign Het
Other mutations in Cyp2a22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Cyp2a22 APN 7 26937738 missense probably benign 0.09
IGL01111:Cyp2a22 APN 7 26936458 missense probably damaging 1.00
IGL01388:Cyp2a22 APN 7 26937792 missense probably benign 0.02
IGL01449:Cyp2a22 APN 7 26933553 missense probably benign 0.01
IGL01642:Cyp2a22 APN 7 26938759 missense possibly damaging 0.81
IGL02253:Cyp2a22 APN 7 26938237 splice site probably benign
IGL02327:Cyp2a22 APN 7 26934781 missense probably damaging 0.99
IGL02673:Cyp2a22 APN 7 26938100 missense probably benign 0.00
IGL02813:Cyp2a22 APN 7 26936434 missense probably benign 0.19
IGL02896:Cyp2a22 APN 7 26936461 missense probably damaging 0.98
IGL03193:Cyp2a22 APN 7 26936421 missense probably benign 0.00
IGL03350:Cyp2a22 APN 7 26934854 missense possibly damaging 0.88
R1648:Cyp2a22 UTSW 7 26932368 missense probably damaging 0.98
R1679:Cyp2a22 UTSW 7 26936311 nonsense probably null
R1733:Cyp2a22 UTSW 7 26934762 missense possibly damaging 0.78
R2001:Cyp2a22 UTSW 7 26934772 missense probably damaging 1.00
R2858:Cyp2a22 UTSW 7 26934262 missense probably damaging 0.99
R3054:Cyp2a22 UTSW 7 26938829 missense probably damaging 1.00
R4528:Cyp2a22 UTSW 7 26934769 missense possibly damaging 0.95
R4623:Cyp2a22 UTSW 7 26933491 missense probably damaging 1.00
R4669:Cyp2a22 UTSW 7 26937855 missense possibly damaging 0.88
R4690:Cyp2a22 UTSW 7 26939209 nonsense probably null
R4840:Cyp2a22 UTSW 7 26932524 missense probably benign 0.13
R4915:Cyp2a22 UTSW 7 26937770 missense probably benign 0.33
R5071:Cyp2a22 UTSW 7 26932481 missense probably benign 0.01
R5072:Cyp2a22 UTSW 7 26932481 missense probably benign 0.01
R5074:Cyp2a22 UTSW 7 26932481 missense probably benign 0.01
R5147:Cyp2a22 UTSW 7 26936325 missense probably damaging 1.00
R5363:Cyp2a22 UTSW 7 26936433 missense probably damaging 0.99
R6014:Cyp2a22 UTSW 7 26939180 splice site probably null
R6042:Cyp2a22 UTSW 7 26934239 missense probably damaging 1.00
R6253:Cyp2a22 UTSW 7 26934232 missense probably benign 0.18
R6757:Cyp2a22 UTSW 7 26939204 missense probably benign 0.00
R6994:Cyp2a22 UTSW 7 26939181 critical splice donor site probably null
R7581:Cyp2a22 UTSW 7 26938148 missense possibly damaging 0.87
R8212:Cyp2a22 UTSW 7 26937780 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- CAAAGTCTTGAAATAGCTCCAGAG -3'
(R):5'- GAGCAAAGGCCATCTTCTGC -3'

Sequencing Primer
(F):5'- GCCTTCTAAACCCCACTAGTAAGAG -3'
(R):5'- GTAGAATCTCAGCCTTGGCTATCAG -3'
Posted On2017-01-03