Mutagenetix > Incidental Mutation

Incidental Mutation 'R0551:Arhgap39'

45194

Institutional Source

Beutler Lab

Gene Symbol

Arhgap39

Ensembl Gene

ENSMUSG00000033697

Gene Name

Rho GTPase activating protein 39

Synonyms

D15Wsu169e

MMRRC Submission

038743-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.232) question?

Stock #

R0551 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

76723985-76818170 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 76734886 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Asparagine at position 833 (D833N)

Ref Sequence

ENSEMBL: ENSMUSP00000076993 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000036176] [ENSMUST00000077821]

AlphaFold

P59281

Predicted Effect

possibly damaging
Transcript: ENSMUST00000036176
AA Change: D833N

PolyPhen 2 Score 0.835 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000036697
Gene: ENSMUSG00000033697
AA Change: D833N

Domain	Start	End	E-Value	Type
WW	27	60	1.64e0	SMART
WW	66	99	5.41e-1	SMART
low complexity region	125	138	N/A	INTRINSIC
low complexity region	304	318	N/A	INTRINSIC
Pfam:MyTH4	759	904	2.3e-32	PFAM
RhoGAP	932	1105	5.9e-28	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000077821
AA Change: D833N

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000076993
Gene: ENSMUSG00000033697
AA Change: D833N

Domain	Start	End	E-Value	Type
WW	27	60	1.64e0	SMART
WW	66	99	5.41e-1	SMART
low complexity region	125	138	N/A	INTRINSIC
low complexity region	304	318	N/A	INTRINSIC
Pfam:MyTH4	756	874	3.3e-25	PFAM
RhoGAP	901	1074	5.9e-28	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000177011

Meta Mutation Damage Score

0.1155

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.1%
20x: 95.1%

Validation Efficiency

99% (77/78)

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3425401B19Rik	T	A	14: 32,662,641	T456S	probably benign	Het
5830473C10Rik	C	T	5: 90,572,719	P250S	probably damaging	Het
Acmsd	A	T	1: 127,766,333	K333N	probably benign	Het
Adcy2	T	A	13: 68,796,539	K241N	probably damaging	Het
Aebp1	A	G	11: 5,867,955	I77V	probably benign	Het
Ankrd35	A	G	3: 96,683,960	T521A	probably benign	Het
Arap2	C	T	5: 62,641,323		probably null	Het
Arfgap3	A	T	15: 83,343,137	C25S	probably damaging	Het
Arhgap20	T	A	9: 51,825,825		probably benign	Het
Auts2	T	C	5: 131,440,469	E446G	possibly damaging	Het
Brwd1	C	T	16: 96,035,974	R886H	probably damaging	Het
Carm1	G	A	9: 21,580,491		probably null	Het
Cdc5l	G	A	17: 45,415,684	R321W	probably damaging	Het
Cfap54	A	T	10: 93,025,122	M841K	probably benign	Het
Clca4b	T	A	3: 144,928,626	T69S	probably damaging	Het
Cpox	A	G	16: 58,675,390	I357V	probably benign	Het
Diaph3	C	A	14: 86,910,100	V711L	probably benign	Het
Fabp3-ps1	T	C	10: 86,732,040		probably benign	Het
Fam120b	A	T	17: 15,431,643		probably benign	Het
Fcho1	A	G	8: 71,712,174	S488P	probably benign	Het
Flcn	A	G	11: 59,795,748		probably null	Het
Flt3l	A	G	7: 45,132,266	W234R	probably damaging	Het
Fzd7	G	T	1: 59,483,284	V109L	probably damaging	Het
G3bp1	A	G	11: 55,489,143	N101S	probably benign	Het
Gadd45g	A	G	13: 51,847,927	E143G	probably damaging	Het
Ganab	T	G	19: 8,907,280	I149S	probably benign	Het
Garnl3	A	G	2: 33,016,738	S413P	probably damaging	Het
Glis1	C	T	4: 107,568,119		probably null	Het
Gm11563	A	G	11: 99,658,713	S72P	unknown	Het
Gpd1	T	G	15: 99,720,629	I188S	possibly damaging	Het
Gria2	A	G	3: 80,732,026		probably benign	Het
H2afy2	A	G	10: 61,741,166	S308P	probably damaging	Het
Hpcal4	G	T	4: 123,189,055	A65S	possibly damaging	Het
Igsf10	G	A	3: 59,328,668	T1364I	probably benign	Het
Kdm4a	T	C	4: 118,138,231	*1065W	probably null	Het
Klkb1	A	G	8: 45,277,966		probably null	Het
Lipo3	T	C	19: 33,580,551	D147G	probably damaging	Het
Lrp1	A	G	10: 127,571,958	S1821P	probably benign	Het
Manba	T	C	3: 135,517,973	I207T	probably damaging	Het
Mark3	T	A	12: 111,633,634	S428T	probably benign	Het
Mfsd4a	G	A	1: 132,041,919	T348I	probably damaging	Het
Mfsd7a	A	G	5: 108,444,465		probably benign	Het
Mybbp1a	A	G	11: 72,448,376	M880V	probably benign	Het
N4bp2	T	A	5: 65,820,341		probably null	Het
Nrd1	T	G	4: 109,047,708	I712S	probably damaging	Het
Nup210	G	A	6: 91,021,484	R774C	possibly damaging	Het
Obscn	G	A	11: 59,107,862	R1395*	probably null	Het
Olfr1454	T	A	19: 13,064,294	D294E	probably benign	Het
Pcdh7	T	C	5: 57,721,994	Y964H	probably damaging	Het
Plin4	T	C	17: 56,106,756	T290A	probably benign	Het
Ppara	T	C	15: 85,787,105		probably benign	Het
Psg21	T	G	7: 18,652,640		probably null	Het
Ptar1	C	A	19: 23,720,340	N405K	probably benign	Het
Ralgps2	A	G	1: 156,832,663		probably null	Het
Rnf6	T	A	5: 146,211,395	N271I	possibly damaging	Het
Sis	T	C	3: 72,925,407	D1019G	possibly damaging	Het
Slc37a3	A	G	6: 39,352,754		probably benign	Het
Slc6a12	G	A	6: 121,356,918	V238I	probably damaging	Het
Sntg1	C	A	1: 8,554,736	V279L	possibly damaging	Het
Sorbs1	T	A	19: 40,311,816	E567D	probably damaging	Het
Sp110	C	A	1: 85,589,100		probably benign	Het
Ssu2	A	G	6: 112,380,554	V175A	possibly damaging	Het
Stk36	G	A	1: 74,616,621	E428K	probably benign	Het
Teddm1b	A	T	1: 153,875,344	I300F	possibly damaging	Het
Thy1	T	C	9: 44,047,348	V129A	probably damaging	Het
Tiam2	T	A	17: 3,428,954	M654K	probably damaging	Het
Tmem69	T	C	4: 116,553,273	S167G	probably benign	Het
Tmem8	C	A	17: 26,120,602	Q605K	probably damaging	Het
Tmem81	C	G	1: 132,507,829	I124M	probably damaging	Het
Tspan10	A	G	11: 120,444,418	D118G	probably damaging	Het
Tspo2	A	G	17: 48,448,813		probably benign	Het
Ttn	G	A	2: 76,908,328	Q4002*	probably null	Het
Tyro3	G	A	2: 119,816,904	R834Q	probably damaging	Het
Ugt2b1	T	C	5: 86,926,084	K139E	probably benign	Het
Vmn1r9	A	T	6: 57,071,539	I200F	probably benign	Het

Other mutations in Arhgap39

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01547:Arhgap39	APN	15	76737815	splice site	probably benign
IGL01586:Arhgap39	APN	15	76730438	missense	probably benign	0.16
IGL01693:Arhgap39	APN	15	76725967	missense	probably null	1.00
IGL02017:Arhgap39	APN	15	76737037	missense	probably damaging	0.98
IGL02508:Arhgap39	APN	15	76724984	makesense	probably null
IGL03333:Arhgap39	APN	15	76726732	missense	probably benign	0.05
R0328:Arhgap39	UTSW	15	76751952	splice site	probably benign
R0432:Arhgap39	UTSW	15	76734886	missense	probably damaging	0.99
R0479:Arhgap39	UTSW	15	76734886	missense	probably damaging	0.99
R0549:Arhgap39	UTSW	15	76734886	missense	probably damaging	0.99
R1054:Arhgap39	UTSW	15	76751559	missense	probably benign
R1830:Arhgap39	UTSW	15	76735183	missense	probably damaging	1.00
R2421:Arhgap39	UTSW	15	76725146	missense	probably damaging	1.00
R2497:Arhgap39	UTSW	15	76725385	missense	probably damaging	1.00
R3909:Arhgap39	UTSW	15	76751888	missense	probably benign	0.03
R4410:Arhgap39	UTSW	15	76725512	unclassified	probably benign
R4626:Arhgap39	UTSW	15	76737637	missense	possibly damaging	0.92
R4790:Arhgap39	UTSW	15	76726731	missense	possibly damaging	0.51
R4792:Arhgap39	UTSW	15	76741517	missense	possibly damaging	0.92
R4911:Arhgap39	UTSW	15	76737805	missense	probably damaging	1.00
R5225:Arhgap39	UTSW	15	76725515	unclassified	probably benign
R5417:Arhgap39	UTSW	15	76735101	missense	possibly damaging	0.80
R5443:Arhgap39	UTSW	15	76797925	intron	probably benign
R5521:Arhgap39	UTSW	15	76765494	missense	possibly damaging	0.66
R5686:Arhgap39	UTSW	15	76726633	missense	probably damaging	1.00
R5747:Arhgap39	UTSW	15	76741535	missense	possibly damaging	0.68
R5785:Arhgap39	UTSW	15	76737418	missense	probably benign
R5879:Arhgap39	UTSW	15	76751807	missense	probably damaging	1.00
R6035:Arhgap39	UTSW	15	76737224	nonsense	probably null
R6035:Arhgap39	UTSW	15	76737224	nonsense	probably null
R6049:Arhgap39	UTSW	15	76727401	critical splice donor site	probably null
R6143:Arhgap39	UTSW	15	76730406	nonsense	probably null
R6232:Arhgap39	UTSW	15	76736512	missense	probably damaging	1.00
R6276:Arhgap39	UTSW	15	76737536	missense	probably benign	0.06
R6277:Arhgap39	UTSW	15	76735137	missense	probably damaging	1.00
R6305:Arhgap39	UTSW	15	76737702	missense	probably benign	0.31
R6587:Arhgap39	UTSW	15	76737499	missense	probably damaging	1.00
R7153:Arhgap39	UTSW	15	76765491	missense	probably benign	0.09
R7447:Arhgap39	UTSW	15	76765597	start gained	probably benign
R7658:Arhgap39	UTSW	15	76737417	missense	probably benign	0.03
R8071:Arhgap39	UTSW	15	76737502	missense	probably benign
R8269:Arhgap39	UTSW	15	76751742	missense	probably benign	0.35
R8368:Arhgap39	UTSW	15	76735255	missense	probably damaging	1.00
R9124:Arhgap39	UTSW	15	76735267	missense	probably damaging	1.00
R9333:Arhgap39	UTSW	15	76735125	missense	probably damaging	1.00
R9438:Arhgap39	UTSW	15	76751918	missense	probably damaging	0.96
R9602:Arhgap39	UTSW	15	76726754	missense	probably damaging	0.98
R9615:Arhgap39	UTSW	15	76737238	missense	probably benign	0.02
R9700:Arhgap39	UTSW	15	76727417	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- AGGTTCTCTGAGGCTACAAGGCAG -3'
(R):5'- AGCAGTGAGTCCATCAAGAAGCCC -3'

Sequencing Primer
(F):5'- CAGAGGAAACTAGGCTTTGGG -3'
(R):5'- ATTGTGACTAGTGACCGGCAC -3'

Posted On

2013-06-11