Incidental Mutation 'R5705:Srcin1'
ID451940
Institutional Source Beutler Lab
Gene Symbol Srcin1
Ensembl Gene ENSMUSG00000038453
Gene NameSRC kinase signaling inhibitor 1
Synonymsp140Cap, P140
MMRRC Submission 043330-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5705 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location97509340-97576186 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 97548951 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 152 (C152R)
Ref Sequence ENSEMBL: ENSMUSP00000116444 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107590] [ENSMUST00000107593] [ENSMUST00000107596] [ENSMUST00000126287] [ENSMUST00000207653]
Predicted Effect probably benign
Transcript: ENSMUST00000107590
SMART Domains Protein: ENSMUSP00000103216
Gene: ENSMUSG00000038453

DomainStartEndE-ValueType
low complexity region 26 45 N/A INTRINSIC
low complexity region 66 75 N/A INTRINSIC
Blast:THAP 113 142 1e-9 BLAST
low complexity region 332 366 N/A INTRINSIC
low complexity region 489 501 N/A INTRINSIC
low complexity region 516 538 N/A INTRINSIC
low complexity region 558 575 N/A INTRINSIC
low complexity region 655 679 N/A INTRINSIC
low complexity region 699 712 N/A INTRINSIC
coiled coil region 751 784 N/A INTRINSIC
low complexity region 1034 1051 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107593
SMART Domains Protein: ENSMUSP00000103219
Gene: ENSMUSG00000038453

DomainStartEndE-ValueType
low complexity region 26 45 N/A INTRINSIC
low complexity region 66 75 N/A INTRINSIC
Blast:THAP 113 142 1e-9 BLAST
low complexity region 332 366 N/A INTRINSIC
low complexity region 489 501 N/A INTRINSIC
low complexity region 516 538 N/A INTRINSIC
low complexity region 558 575 N/A INTRINSIC
low complexity region 655 679 N/A INTRINSIC
low complexity region 699 712 N/A INTRINSIC
coiled coil region 751 784 N/A INTRINSIC
low complexity region 1034 1051 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107596
AA Change: C118R

PolyPhen 2 Score 0.380 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000103222
Gene: ENSMUSG00000038453
AA Change: C118R

DomainStartEndE-ValueType
low complexity region 32 41 N/A INTRINSIC
Blast:THAP 79 108 8e-10 BLAST
low complexity region 118 128 N/A INTRINSIC
Pfam:AIP3 218 330 2e-11 PFAM
low complexity region 331 365 N/A INTRINSIC
low complexity region 488 500 N/A INTRINSIC
low complexity region 515 537 N/A INTRINSIC
low complexity region 557 574 N/A INTRINSIC
low complexity region 654 678 N/A INTRINSIC
low complexity region 698 711 N/A INTRINSIC
coiled coil region 750 783 N/A INTRINSIC
low complexity region 1033 1050 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126287
AA Change: C152R

PolyPhen 2 Score 0.418 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000116444
Gene: ENSMUSG00000038453
AA Change: C152R

DomainStartEndE-ValueType
low complexity region 26 45 N/A INTRINSIC
low complexity region 66 75 N/A INTRINSIC
Blast:THAP 113 142 7e-10 BLAST
low complexity region 152 162 N/A INTRINSIC
Pfam:AIP3 244 339 9.7e-10 PFAM
low complexity region 357 391 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142123
Predicted Effect probably benign
Transcript: ENSMUST00000207653
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele display abnormalities in object recognition memory and motor learning, dendritic spine disorganization, impaired synaptic plasticity, and reduced long term potentiation and long term depression. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T C 10: 80,015,442 V2163A probably benign Het
Abcg3 G A 5: 104,968,170 A266V probably damaging Het
Ago1 T C 4: 126,448,794 I519V probably benign Het
Arhgap4 G A X: 73,906,817 R43W probably damaging Het
Aurkb T A 11: 69,048,815 L213I possibly damaging Het
Bod1l T A 5: 41,817,002 Q2323L probably benign Het
Ccdc17 C T 4: 116,596,869 T28I probably benign Het
Ccdc39 T C 3: 33,816,937 E630G probably damaging Het
Cnih4 A G 1: 181,153,735 I24V probably benign Het
Ctse C A 1: 131,664,374 T146K possibly damaging Het
Ctsr A G 13: 61,161,264 F226L probably damaging Het
Cyp2a22 T C 7: 26,939,215 N49D probably benign Het
Defb23 C T 2: 152,459,284 A123T probably benign Het
Dtx2 C A 5: 136,010,295 D69E probably damaging Het
Eps8l1 T C 7: 4,470,035 V91A probably benign Het
Eps8l3 C A 3: 107,891,264 Q489K probably benign Het
Esyt3 A G 9: 99,318,207 S645P probably benign Het
Fam161a T A 11: 23,028,869 M472K unknown Het
Fam196b A G 11: 34,404,349 Y473C probably damaging Het
Fam26e A T 10: 34,095,993 C149S probably damaging Het
Glp2r A G 11: 67,709,739 V428A probably benign Het
Gnl1 G A 17: 35,981,600 V191I probably benign Het
Hfm1 T C 5: 106,911,453 I234M probably benign Het
Hlx T C 1: 184,730,865 T197A probably benign Het
Hs3st2 T C 7: 121,393,082 L85P probably damaging Het
Igsf9 T C 1: 172,494,771 V511A possibly damaging Het
Kcnma1 A T 14: 24,003,771 C54S possibly damaging Het
Klhdc4 A G 8: 121,804,993 V181A probably benign Het
Ldb3 T C 14: 34,577,029 M213V probably null Het
Mertk C A 2: 128,771,401 Q446K probably benign Het
Ndufs1 A G 1: 63,147,158 V46A probably benign Het
Neurod4 A G 10: 130,271,402 M1T probably null Het
Nlrc5 T A 8: 94,475,757 C162S probably benign Het
Pald1 A G 10: 61,323,297 I785T possibly damaging Het
Pcmt1 T C 10: 7,638,190 I224M possibly damaging Het
Pisd C T 5: 32,737,363 R533H probably benign Het
Plcxd3 C A 15: 4,517,194 Q227K probably benign Het
Polr1b A T 2: 129,105,351 K199* probably null Het
Ppp1r10 T C 17: 35,929,489 V557A probably damaging Het
Ralgapa2 A G 2: 146,449,273 Y248H probably damaging Het
Rsrp1 T C 4: 134,924,020 S32P unknown Het
Setdb2 T G 14: 59,423,365 S110R possibly damaging Het
Syk A G 13: 52,611,047 N70S probably benign Het
Tlr4 T A 4: 66,833,980 D59E probably damaging Het
Tm9sf4 T A 2: 153,182,458 I67N probably benign Het
Trim30b T A 7: 104,357,577 Y24F probably damaging Het
Tsga13 A G 6: 30,900,016 S189P probably damaging Het
Tspan33 A G 6: 29,717,233 D210G probably benign Het
Use1 G T 8: 71,369,687 R278L probably damaging Het
Wwc1 T C 11: 35,876,596 N403D probably damaging Het
Zfp263 C T 16: 3,746,454 P203S probably benign Het
Other mutations in Srcin1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01874:Srcin1 APN 11 97533098 missense possibly damaging 0.81
IGL03347:Srcin1 APN 11 97525344 missense probably damaging 1.00
R1619:Srcin1 UTSW 11 97525481 missense probably damaging 1.00
R1678:Srcin1 UTSW 11 97518644 missense probably damaging 0.99
R1733:Srcin1 UTSW 11 97533501 missense probably benign
R2023:Srcin1 UTSW 11 97526046 missense probably benign
R2238:Srcin1 UTSW 11 97534819 missense probably benign 0.00
R3983:Srcin1 UTSW 11 97525553 missense probably damaging 1.00
R4572:Srcin1 UTSW 11 97534934 missense probably damaging 1.00
R4628:Srcin1 UTSW 11 97548926 missense probably benign 0.12
R4946:Srcin1 UTSW 11 97551942 missense probably damaging 1.00
R5175:Srcin1 UTSW 11 97573877 missense probably damaging 0.99
R5424:Srcin1 UTSW 11 97537059 nonsense probably null
R5918:Srcin1 UTSW 11 97533497 unclassified probably null
R6563:Srcin1 UTSW 11 97534774 missense possibly damaging 0.74
R6613:Srcin1 UTSW 11 97533827 missense possibly damaging 0.94
R6756:Srcin1 UTSW 11 97535010 missense probably damaging 1.00
R6805:Srcin1 UTSW 11 97551980 critical splice acceptor site probably null
R7060:Srcin1 UTSW 11 97573885 missense probably damaging 0.99
R7271:Srcin1 UTSW 11 97551889 missense probably damaging 0.99
R7304:Srcin1 UTSW 11 97551693 missense probably benign 0.01
R7469:Srcin1 UTSW 11 97534609 missense probably damaging 0.98
R7567:Srcin1 UTSW 11 97534725 missense probably damaging 1.00
R7846:Srcin1 UTSW 11 97526100 nonsense probably null
R7929:Srcin1 UTSW 11 97526100 nonsense probably null
X0024:Srcin1 UTSW 11 97536468 missense probably damaging 1.00
Z1176:Srcin1 UTSW 11 97518727 missense possibly damaging 0.88
Z1177:Srcin1 UTSW 11 97526861 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTTGAAAGTGGAGTATTCGCAC -3'
(R):5'- ACAGAAATACTTGGGGCCCTAC -3'

Sequencing Primer
(F):5'- GTGGAGTATTCGCACATAAAAGAG -3'
(R):5'- TTGGGGCCCTACTTAAAAGTACCAG -3'
Posted On2017-01-03