Mutagenetix > Incidental Mutations

Incidental Mutation 'R5706:Spag16'

451952

Institutional Source

Beutler Lab

Gene Symbol

Spag16

Ensembl Gene

ENSMUSG00000053153

Gene Name

sperm associated antigen 16

Synonyms

4930585K05Rik, Pf20, 4930524F24Rik, Wdr29, 4921511D23Rik

MMRRC Submission

043331-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.207) question?

Stock #

R5706 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

69826970-70725132 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 69870289 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 182 (T182A)

Ref Sequence

ENSEMBL: ENSMUSP00000109573 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065425] [ENSMUST00000113940]

Predicted Effect

probably benign
Transcript: ENSMUST00000065425
AA Change: T182A

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000069821
Gene: ENSMUSG00000053153
AA Change: T182A

Domain	Start	End	E-Value	Type
low complexity region	45	55	N/A	INTRINSIC
coiled coil region	146	190	N/A	INTRINSIC
WD40	349	388	7.8e-2	SMART
WD40	391	430	6.23e-10	SMART
WD40	433	472	1.34e-9	SMART
WD40	475	514	1.92e-10	SMART
WD40	517	556	2.38e-6	SMART
WD40	559	598	1.42e2	SMART
WD40	600	639	4.83e-7	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000113940
AA Change: T182A

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000109573
Gene: ENSMUSG00000053153
AA Change: T182A

Domain	Start	End	E-Value	Type
low complexity region	45	55	N/A	INTRINSIC
coiled coil region	146	190	N/A	INTRINSIC
low complexity region	342	347	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161131

SMART Domains

Protein: ENSMUSP00000124372
Gene: ENSMUSG00000053153

Domain	Start	End	E-Value	Type
low complexity region	45	55	N/A	INTRINSIC
coiled coil region	146	190	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000187159

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000190833

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cilia and flagella are comprised of a microtubular backbone, the axoneme, which is organized by the basal body and surrounded by plasma membrane. SPAG16 encodes 2 major proteins that associate with the axoneme of sperm tail and the nucleus of postmeiotic germ cells, respectively (Zhang et al., 2007 [PubMed 17699735]).[supplied by OMIM, Jul 2008]
PHENOTYPE: Chimeric males carrying one copy of the mutated allele have impaired spermatogenesis, a significant loss of germ cells at the round spermatid stage, and disorganized sperm axoneme structure. No offspring carrying the mutated allele are produced from matings using male chimeras. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca4	T	A	3: 122,054,261	M77K	probably benign	Het
Amy1	A	G	3: 113,556,120	V467A	probably damaging	Het
Atf4	T	C	15: 80,256,330	V11A	possibly damaging	Het
B4galt1	T	C	4: 40,807,268	N373D	probably damaging	Het
Bpifa3	A	G	2: 154,135,578	K112R	probably damaging	Het
Chd2	T	A	7: 73,491,357	Y596F	possibly damaging	Het
Clspn	T	C	4: 126,578,418	S962P	probably damaging	Het
Cyp2c68	T	C	19: 39,734,318	D262G	possibly damaging	Het
Dcaf11	T	C	14: 55,565,695	I282T	probably damaging	Het
Dmxl1	T	C	18: 49,957,395		probably null	Het
Dnah11	T	G	12: 118,023,935	K2411Q	probably damaging	Het
Elf3	A	G	1: 135,256,482	V196A	probably benign	Het
Fhad1	T	G	4: 141,954,116	T538P	probably damaging	Het
Fkbp10	A	G	11: 100,421,023	D174G	probably damaging	Het
Gas6	A	G	8: 13,477,098	S217P	probably damaging	Het
Gm4778	T	A	3: 94,266,652	H322Q	possibly damaging	Het
Heatr5b	C	T	17: 78,766,875		probably null	Het
Iqgap3	A	G	3: 88,115,908	E502G	probably benign	Het
Klc1	T	C	12: 111,795,627	V577A	possibly damaging	Het
Lck	T	C	4: 129,551,638		probably null	Het
Mc3r	C	A	2: 172,249,690	Y277*	probably null	Het
Mlxipl	T	C	5: 135,133,604	V640A	probably benign	Het
Mrc2	A	T	11: 105,332,343	N471Y	probably damaging	Het
Ncan	T	A	8: 70,102,017	H1050L	probably damaging	Het
Nrl	C	A	14: 55,522,432	V13F	probably damaging	Het
Obscn	T	A	11: 59,076,256	Y546F	probably damaging	Het
Olfr214	A	G	6: 116,557,113	I229M	probably damaging	Het
Olfr654	T	G	7: 104,587,890	S46A	probably benign	Het
Olfr799	A	G	10: 129,648,091		probably null	Het
Pde3b	G	A	7: 114,521,692	G684D	probably damaging	Het
Prkaa1	C	T	15: 5,174,342	T244I	probably benign	Het
Scfd2	A	T	5: 74,206,398		probably null	Het
Slc22a30	G	A	19: 8,344,393	Q436*	probably null	Het
Smg1	A	T	7: 118,145,590	V3113D	possibly damaging	Het
Sorbs1	T	C	19: 40,376,881	T153A	probably benign	Het
Svs2	T	C	2: 164,237,669	K106R	possibly damaging	Het
Tenm1	A	G	X: 43,074,695	V107A	possibly damaging	Het
Topaz1	A	T	9: 122,799,485	I1546F	possibly damaging	Het
Tubgcp2	C	A	7: 140,032,225	E78*	probably null	Het
Vars	A	G	17: 35,005,481		probably null	Het
Vmn2r109	A	T	17: 20,554,305	W263R	probably benign	Het

Other mutations in Spag16

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00793:Spag16	APN	1	70299650	missense	probably damaging	1.00
IGL01129:Spag16	APN	1	69896522	missense	probably benign	0.01
IGL02117:Spag16	APN	1	69870320	missense	probably damaging	1.00
IGL02245:Spag16	APN	1	69858502	missense	probably benign
IGL02492:Spag16	APN	1	69887529	missense	probably benign
IGL02851:Spag16	APN	1	70264908	missense	possibly damaging	0.76
IGL03271:Spag16	APN	1	69853352	missense	probably benign	0.00
IGL03274:Spag16	APN	1	69844381	splice site	probably benign
PIT4243001:Spag16	UTSW	1	69853381	missense	probably damaging	1.00
R0084:Spag16	UTSW	1	69996839	missense	probably benign	0.02
R0513:Spag16	UTSW	1	70493768	splice site	probably benign
R0653:Spag16	UTSW	1	69870345	missense	probably damaging	1.00
R1165:Spag16	UTSW	1	69996877	missense	probably benign	0.04
R1178:Spag16	UTSW	1	69923658	splice site	probably benign
R1180:Spag16	UTSW	1	69923658	splice site	probably benign
R1404:Spag16	UTSW	1	69895280	splice site	probably benign
R1547:Spag16	UTSW	1	69873243	missense	possibly damaging	0.51
R1689:Spag16	UTSW	1	70461118	missense	probably benign	0.01
R1699:Spag16	UTSW	1	69996856	missense	probably benign	0.05
R1714:Spag16	UTSW	1	69843005	missense	probably damaging	0.97
R1724:Spag16	UTSW	1	70493782	missense	probably damaging	1.00
R1873:Spag16	UTSW	1	69896585	splice site	probably benign
R2196:Spag16	UTSW	1	69858522	missense	possibly damaging	0.92
R2207:Spag16	UTSW	1	70724884	missense	probably benign	0.00
R4058:Spag16	UTSW	1	69853328	missense	probably damaging	0.96
R4276:Spag16	UTSW	1	69873481	intron	probably benign
R4497:Spag16	UTSW	1	70493830	missense	probably damaging	1.00
R4560:Spag16	UTSW	1	69844296	missense	probably benign	0.05
R4648:Spag16	UTSW	1	69827035	missense	probably null	0.99
R4972:Spag16	UTSW	1	70724928	missense	probably damaging	1.00
R5027:Spag16	UTSW	1	69923804	intron	probably benign
R5032:Spag16	UTSW	1	69853352	missense	probably benign	0.00
R5174:Spag16	UTSW	1	70493796	missense	probably damaging	1.00
R5276:Spag16	UTSW	1	69896583	critical splice donor site	probably null
R5537:Spag16	UTSW	1	69827016	missense	probably benign
R5834:Spag16	UTSW	1	69923714	missense	probably benign	0.00
R6131:Spag16	UTSW	1	70725083	splice site	probably null
R6246:Spag16	UTSW	1	69923821	missense	probably benign	0.45
R7164:Spag16	UTSW	1	70724866	missense	possibly damaging	0.88
R7261:Spag16	UTSW	1	70299621	missense	possibly damaging	0.56
R7298:Spag16	UTSW	1	69919426	splice site	probably null
R7358:Spag16	UTSW	1	69844367	missense	probably benign	0.00
R7431:Spag16	UTSW	1	69923872	missense	unknown
R7508:Spag16	UTSW	1	69887520	missense	possibly damaging	0.93
R7566:Spag16	UTSW	1	69870328	missense	probably damaging	1.00
R7570:Spag16	UTSW	1	69996841	missense	probably benign	0.00
R7598:Spag16	UTSW	1	69870308	missense	probably damaging	1.00
R7942:Spag16	UTSW	1	69827088	missense	probably benign	0.11
R8047:Spag16	UTSW	1	69842996	missense	probably damaging	1.00
R8132:Spag16	UTSW	1	70381302	missense	probably damaging	1.00
R8329:Spag16	UTSW	1	69895248	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GTCCTTTCATGCCTCAGTGATG -3'
(R):5'- ATGGCTTCAATTCAAGGGCC -3'

Sequencing Primer
(F):5'- TGATGTAGAGTAAGACCCCGTCC -3'
(R):5'- GGCTTCAATTCAAGGGCCTAAACTTC -3'

Posted On

2017-01-03