Incidental Mutation 'R5706:Elf3'
ID451954
Institutional Source Beutler Lab
Gene Symbol Elf3
Ensembl Gene ENSMUSG00000003051
Gene NameE74-like factor 3
SynonymsESX, jen, ESE-1
MMRRC Submission 043331-MU
Accession Numbers

Ncbi RefSeq: NM_001163131.1, NM_007921.3; MGI:1101781

Is this an essential gene? Probably essential (E-score: 0.822) question?
Stock #R5706 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location135253575-135258568 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 135256482 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 196 (V196A)
Ref Sequence ENSEMBL: ENSMUSP00000139769 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003135] [ENSMUST00000185752]
Predicted Effect probably benign
Transcript: ENSMUST00000003135
AA Change: V216A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000003135
Gene: ENSMUSG00000003051
AA Change: V216A

DomainStartEndE-ValueType
SAM_PNT 67 151 6.32e-30 SMART
low complexity region 230 241 N/A INTRINSIC
AT_hook 264 276 1.29e0 SMART
ETS 292 379 6.11e-49 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180981
Predicted Effect probably benign
Transcript: ENSMUST00000185752
AA Change: V196A

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000139769
Gene: ENSMUSG00000003051
AA Change: V196A

DomainStartEndE-ValueType
SAM_PNT 47 131 1.36e-29 SMART
low complexity region 210 221 N/A INTRINSIC
AT_hook 244 256 1.29e0 SMART
ETS 272 359 6.11e-49 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188895
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype Strain: 2662485
Lethality: D11-D21
PHENOTYPE: About one third of mice homozygous for a reporter allele die at E11.5; over half of those born develop a wasted phenotype, lethargy and watery diarrhea and die during the first few weeks of life exhibiting dysmorphogenesis and altered differentiation of small intestinal epithelium. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(3)

Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T A 3: 122,054,261 M77K probably benign Het
Amy1 A G 3: 113,556,120 V467A probably damaging Het
Atf4 T C 15: 80,256,330 V11A possibly damaging Het
B4galt1 T C 4: 40,807,268 N373D probably damaging Het
Bpifa3 A G 2: 154,135,578 K112R probably damaging Het
Chd2 T A 7: 73,491,357 Y596F possibly damaging Het
Clspn T C 4: 126,578,418 S962P probably damaging Het
Cyp2c68 T C 19: 39,734,318 D262G possibly damaging Het
Dcaf11 T C 14: 55,565,695 I282T probably damaging Het
Dmxl1 T C 18: 49,957,395 probably null Het
Dnah11 T G 12: 118,023,935 K2411Q probably damaging Het
Fhad1 T G 4: 141,954,116 T538P probably damaging Het
Fkbp10 A G 11: 100,421,023 D174G probably damaging Het
Gas6 A G 8: 13,477,098 S217P probably damaging Het
Gm4778 T A 3: 94,266,652 H322Q possibly damaging Het
Heatr5b C T 17: 78,766,875 probably null Het
Iqgap3 A G 3: 88,115,908 E502G probably benign Het
Klc1 T C 12: 111,795,627 V577A possibly damaging Het
Lck T C 4: 129,551,638 probably null Het
Mc3r C A 2: 172,249,690 Y277* probably null Het
Mlxipl T C 5: 135,133,604 V640A probably benign Het
Mrc2 A T 11: 105,332,343 N471Y probably damaging Het
Ncan T A 8: 70,102,017 H1050L probably damaging Het
Nrl C A 14: 55,522,432 V13F probably damaging Het
Obscn T A 11: 59,076,256 Y546F probably damaging Het
Olfr214 A G 6: 116,557,113 I229M probably damaging Het
Olfr654 T G 7: 104,587,890 S46A probably benign Het
Olfr799 A G 10: 129,648,091 probably null Het
Pde3b G A 7: 114,521,692 G684D probably damaging Het
Prkaa1 C T 15: 5,174,342 T244I probably benign Het
Scfd2 A T 5: 74,206,398 probably null Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Smg1 A T 7: 118,145,590 V3113D possibly damaging Het
Sorbs1 T C 19: 40,376,881 T153A probably benign Het
Spag16 A G 1: 69,870,289 T182A probably benign Het
Svs2 T C 2: 164,237,669 K106R possibly damaging Het
Tenm1 A G X: 43,074,695 V107A possibly damaging Het
Topaz1 A T 9: 122,799,485 I1546F possibly damaging Het
Tubgcp2 C A 7: 140,032,225 E78* probably null Het
Vars A G 17: 35,005,481 probably null Het
Vmn2r109 A T 17: 20,554,305 W263R probably benign Het
Other mutations in Elf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02141:Elf3 APN 1 135257707 missense possibly damaging 0.94
IGL02470:Elf3 APN 1 135255012 missense probably damaging 1.00
IGL03018:Elf3 APN 1 135256065 missense possibly damaging 0.62
IGL03252:Elf3 APN 1 135254953 missense probably damaging 1.00
P0026:Elf3 UTSW 1 135255973 critical splice donor site probably null
R0087:Elf3 UTSW 1 135257137 missense probably damaging 1.00
R1842:Elf3 UTSW 1 135256793 missense possibly damaging 0.65
R1897:Elf3 UTSW 1 135257137 missense probably damaging 1.00
R2081:Elf3 UTSW 1 135257076 missense probably benign 0.12
R4049:Elf3 UTSW 1 135254277 missense probably benign 0.21
R4467:Elf3 UTSW 1 135256844 missense probably damaging 1.00
R4630:Elf3 UTSW 1 135256740 intron probably benign
R4715:Elf3 UTSW 1 135257752 missense probably damaging 1.00
R4923:Elf3 UTSW 1 135256735 intron probably benign
R5226:Elf3 UTSW 1 135257239 missense probably benign 0.07
R5422:Elf3 UTSW 1 135255040 missense probably damaging 0.98
R7115:Elf3 UTSW 1 135257118 missense probably damaging 1.00
R7644:Elf3 UTSW 1 135256506 missense possibly damaging 0.89
R7855:Elf3 UTSW 1 135254352 missense probably damaging 1.00
R7938:Elf3 UTSW 1 135254352 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTTCCACCGGAGTCAGAAG -3'
(R):5'- CATAGTCATTTCTGTGGTCCCTGG -3'

Sequencing Primer
(F):5'- TCAGAAGCATGGGAACTCTG -3'
(R):5'- CTGGAGGGTCGTGCCTGTC -3'
Posted On2017-01-03