Incidental Mutation 'R5706:Bpifa3'
ID451955
Institutional Source Beutler Lab
Gene Symbol Bpifa3
Ensembl Gene ENSMUSG00000027482
Gene NameBPI fold containing family A, member 3
Synonyms
MMRRC Submission 043331-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.049) question?
Stock #R5706 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location154130336-154138356 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 154135578 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 112 (K112R)
Ref Sequence ENSEMBL: ENSMUSP00000105368 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028984] [ENSMUST00000109746] [ENSMUST00000125753]
Predicted Effect probably damaging
Transcript: ENSMUST00000028984
AA Change: K112R

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000028984
Gene: ENSMUSG00000027482
AA Change: K112R

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:LBP_BPI_CETP 47 219 1.2e-35 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109746
AA Change: K112R

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105368
Gene: ENSMUSG00000027482
AA Change: K112R

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:LBP_BPI_CETP 47 219 1e-34 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000125753
AA Change: K12R

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000135866
Gene: ENSMUSG00000027482
AA Change: K12R

DomainStartEndE-ValueType
Pfam:LBP_BPI_CETP 1 95 4.1e-17 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T A 3: 122,054,261 M77K probably benign Het
Amy1 A G 3: 113,556,120 V467A probably damaging Het
Atf4 T C 15: 80,256,330 V11A possibly damaging Het
B4galt1 T C 4: 40,807,268 N373D probably damaging Het
Chd2 T A 7: 73,491,357 Y596F possibly damaging Het
Clspn T C 4: 126,578,418 S962P probably damaging Het
Cyp2c68 T C 19: 39,734,318 D262G possibly damaging Het
Dcaf11 T C 14: 55,565,695 I282T probably damaging Het
Dmxl1 T C 18: 49,957,395 probably null Het
Dnah11 T G 12: 118,023,935 K2411Q probably damaging Het
Elf3 A G 1: 135,256,482 V196A probably benign Het
Fhad1 T G 4: 141,954,116 T538P probably damaging Het
Fkbp10 A G 11: 100,421,023 D174G probably damaging Het
Gas6 A G 8: 13,477,098 S217P probably damaging Het
Gm4778 T A 3: 94,266,652 H322Q possibly damaging Het
Heatr5b C T 17: 78,766,875 probably null Het
Iqgap3 A G 3: 88,115,908 E502G probably benign Het
Klc1 T C 12: 111,795,627 V577A possibly damaging Het
Lck T C 4: 129,551,638 probably null Het
Mc3r C A 2: 172,249,690 Y277* probably null Het
Mlxipl T C 5: 135,133,604 V640A probably benign Het
Mrc2 A T 11: 105,332,343 N471Y probably damaging Het
Ncan T A 8: 70,102,017 H1050L probably damaging Het
Nrl C A 14: 55,522,432 V13F probably damaging Het
Obscn T A 11: 59,076,256 Y546F probably damaging Het
Olfr214 A G 6: 116,557,113 I229M probably damaging Het
Olfr654 T G 7: 104,587,890 S46A probably benign Het
Olfr799 A G 10: 129,648,091 probably null Het
Pde3b G A 7: 114,521,692 G684D probably damaging Het
Prkaa1 C T 15: 5,174,342 T244I probably benign Het
Scfd2 A T 5: 74,206,398 probably null Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Smg1 A T 7: 118,145,590 V3113D possibly damaging Het
Sorbs1 T C 19: 40,376,881 T153A probably benign Het
Spag16 A G 1: 69,870,289 T182A probably benign Het
Svs2 T C 2: 164,237,669 K106R possibly damaging Het
Tenm1 A G X: 43,074,695 V107A possibly damaging Het
Topaz1 A T 9: 122,799,485 I1546F possibly damaging Het
Tubgcp2 C A 7: 140,032,225 E78* probably null Het
Vars A G 17: 35,005,481 probably null Het
Vmn2r109 A T 17: 20,554,305 W263R probably benign Het
Other mutations in Bpifa3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01522:Bpifa3 APN 2 154137582 missense probably damaging 1.00
R0023:Bpifa3 UTSW 2 154138150 missense probably damaging 0.97
R1067:Bpifa3 UTSW 2 154137609 missense probably damaging 1.00
R4163:Bpifa3 UTSW 2 154135596 missense probably damaging 0.97
R4614:Bpifa3 UTSW 2 154136280 missense probably damaging 0.99
R5124:Bpifa3 UTSW 2 154138137 nonsense probably null
R5704:Bpifa3 UTSW 2 154137642 critical splice donor site probably null
R5975:Bpifa3 UTSW 2 154136321 missense probably damaging 0.96
R6116:Bpifa3 UTSW 2 154133713 missense possibly damaging 0.90
R6858:Bpifa3 UTSW 2 154137594 missense probably benign 0.12
Z1176:Bpifa3 UTSW 2 154130471 start gained probably benign
Z1177:Bpifa3 UTSW 2 154136292 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GGTTCTGTACTGCACAATCCAC -3'
(R):5'- TGGGGTCATGAAAGGTCTGAAC -3'

Sequencing Primer
(F):5'- GTACTGCACAATCCACAGCTGTG -3'
(R):5'- AAGGTCTGAACGTCCAAGTCTGC -3'
Posted On2017-01-03