Incidental Mutation 'R5706:Svs2'
ID451956
Institutional Source Beutler Lab
Gene Symbol Svs2
Ensembl Gene ENSMUSG00000040132
Gene Nameseminal vesicle secretory protein 2
Synonymssemenoclotin, SVS II
MMRRC Submission 043331-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5706 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location164235929-164238466 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 164237669 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 106 (K106R)
Ref Sequence ENSEMBL: ENSMUSP00000104999 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044953] [ENSMUST00000109374]
Predicted Effect possibly damaging
Transcript: ENSMUST00000044953
AA Change: K106R

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000042389
Gene: ENSMUSG00000040132
AA Change: K106R

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:SVS_QK 110 121 1.2e-6 PFAM
Pfam:SVS_QK 122 137 3.9e-3 PFAM
Pfam:SVS_QK 139 149 1.3e-5 PFAM
Pfam:SVS_QK 151 166 8.4e-4 PFAM
Pfam:SVS_QK 168 179 5.3e-6 PFAM
Pfam:SVS_QK 180 195 3.9e-3 PFAM
Pfam:SVS_QK 197 207 1.3e-5 PFAM
Pfam:SVS_QK 210 221 8.8e-5 PFAM
Pfam:SVS_QK 225 236 7.7e-6 PFAM
Pfam:SVS_QK 238 249 6.1e-6 PFAM
Pfam:SVS_QK 249 260 5.2e-4 PFAM
Pfam:SVS_QK 262 272 3.1e-5 PFAM
Pfam:SVS_QK 323 334 6.7e-5 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000109374
AA Change: K106R

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000104999
Gene: ENSMUSG00000040132
AA Change: K106R

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:SVS_QK 110 121 1.2e-6 PFAM
Pfam:SVS_QK 122 137 3.9e-3 PFAM
Pfam:SVS_QK 139 149 1.3e-5 PFAM
Pfam:SVS_QK 151 166 8.4e-4 PFAM
Pfam:SVS_QK 168 179 5.3e-6 PFAM
Pfam:SVS_QK 180 195 3.9e-3 PFAM
Pfam:SVS_QK 197 207 1.3e-5 PFAM
Pfam:SVS_QK 210 221 8.8e-5 PFAM
Pfam:SVS_QK 225 236 7.7e-6 PFAM
Pfam:SVS_QK 238 249 6.1e-6 PFAM
Pfam:SVS_QK 249 260 5.2e-4 PFAM
Pfam:SVS_QK 262 272 3.1e-5 PFAM
Pfam:SVS_QK 323 334 6.7e-5 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Male mice homozygous for a null allele display severely reduced fertility with premature acrosome reaction, absence of copulatory plug formation and intrauterine death of sperm. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T A 3: 122,054,261 M77K probably benign Het
Amy1 A G 3: 113,556,120 V467A probably damaging Het
Atf4 T C 15: 80,256,330 V11A possibly damaging Het
B4galt1 T C 4: 40,807,268 N373D probably damaging Het
Bpifa3 A G 2: 154,135,578 K112R probably damaging Het
Chd2 T A 7: 73,491,357 Y596F possibly damaging Het
Clspn T C 4: 126,578,418 S962P probably damaging Het
Cyp2c68 T C 19: 39,734,318 D262G possibly damaging Het
Dcaf11 T C 14: 55,565,695 I282T probably damaging Het
Dmxl1 T C 18: 49,957,395 probably null Het
Dnah11 T G 12: 118,023,935 K2411Q probably damaging Het
Elf3 A G 1: 135,256,482 V196A probably benign Het
Fhad1 T G 4: 141,954,116 T538P probably damaging Het
Fkbp10 A G 11: 100,421,023 D174G probably damaging Het
Gas6 A G 8: 13,477,098 S217P probably damaging Het
Gm4778 T A 3: 94,266,652 H322Q possibly damaging Het
Heatr5b C T 17: 78,766,875 probably null Het
Iqgap3 A G 3: 88,115,908 E502G probably benign Het
Klc1 T C 12: 111,795,627 V577A possibly damaging Het
Lck T C 4: 129,551,638 probably null Het
Mc3r C A 2: 172,249,690 Y277* probably null Het
Mlxipl T C 5: 135,133,604 V640A probably benign Het
Mrc2 A T 11: 105,332,343 N471Y probably damaging Het
Ncan T A 8: 70,102,017 H1050L probably damaging Het
Nrl C A 14: 55,522,432 V13F probably damaging Het
Obscn T A 11: 59,076,256 Y546F probably damaging Het
Olfr214 A G 6: 116,557,113 I229M probably damaging Het
Olfr654 T G 7: 104,587,890 S46A probably benign Het
Olfr799 A G 10: 129,648,091 probably null Het
Pde3b G A 7: 114,521,692 G684D probably damaging Het
Prkaa1 C T 15: 5,174,342 T244I probably benign Het
Scfd2 A T 5: 74,206,398 probably null Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Smg1 A T 7: 118,145,590 V3113D possibly damaging Het
Sorbs1 T C 19: 40,376,881 T153A probably benign Het
Spag16 A G 1: 69,870,289 T182A probably benign Het
Tenm1 A G X: 43,074,695 V107A possibly damaging Het
Topaz1 A T 9: 122,799,485 I1546F possibly damaging Het
Tubgcp2 C A 7: 140,032,225 E78* probably null Het
Vars A G 17: 35,005,481 probably null Het
Vmn2r109 A T 17: 20,554,305 W263R probably benign Het
Other mutations in Svs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Svs2 APN 2 164237042 missense possibly damaging 0.86
IGL01722:Svs2 APN 2 164237526 missense possibly damaging 0.71
IGL03189:Svs2 APN 2 164237112 missense possibly damaging 0.73
R1276:Svs2 UTSW 2 164237248 missense possibly damaging 0.95
R1541:Svs2 UTSW 2 164237009 missense possibly damaging 0.71
R1590:Svs2 UTSW 2 164237658 missense possibly damaging 0.86
R3946:Svs2 UTSW 2 164237127 missense probably benign 0.01
R3965:Svs2 UTSW 2 164237742 missense possibly damaging 0.53
R4075:Svs2 UTSW 2 164237318 missense probably benign 0.01
R4632:Svs2 UTSW 2 164237747 missense probably benign 0.40
R4732:Svs2 UTSW 2 164237123 missense possibly damaging 0.87
R4733:Svs2 UTSW 2 164237123 missense possibly damaging 0.87
R4839:Svs2 UTSW 2 164236886 missense probably benign 0.40
R6936:Svs2 UTSW 2 164237628 missense possibly damaging 0.86
R7052:Svs2 UTSW 2 164238206 missense unknown
R7836:Svs2 UTSW 2 164237580 missense possibly damaging 0.86
R8035:Svs2 UTSW 2 164237133 missense probably benign 0.18
R8100:Svs2 UTSW 2 164237792 missense probably benign 0.08
R8187:Svs2 UTSW 2 164237772 missense possibly damaging 0.88
R8310:Svs2 UTSW 2 164238171 missense probably damaging 1.00
R8312:Svs2 UTSW 2 164238171 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGTCCAAAGGCTGGTCCTC -3'
(R):5'- AAAGGCCACTTCCAGAGCAG -3'

Sequencing Primer
(F):5'- GGTCCTCCAGATTTCAACTGAC -3'
(R):5'- AGAAAGGCCGTCTCAGTTTC -3'
Posted On2017-01-03