Incidental Mutation 'R5706:Svs5'
ID 451956
Institutional Source Beutler Lab
Gene Symbol Svs5
Ensembl Gene ENSMUSG00000017004
Gene Name seminal vesicle secretory protein 5
Synonyms seminal vesicle protein F, Svp-1, Svp1, SVS V, Svp5
MMRRC Submission 043331-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.055) question?
Stock # R5706 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 164174685-164176314 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 164079589 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 106 (K106R)
Ref Sequence ENSEMBL: ENSMUSP00000104999 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044953] [ENSMUST00000109374]
AlphaFold P30933
Predicted Effect possibly damaging
Transcript: ENSMUST00000044953
AA Change: K106R

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000042389
Gene: ENSMUSG00000040132
AA Change: K106R

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:SVS_QK 110 121 1.2e-6 PFAM
Pfam:SVS_QK 122 137 3.9e-3 PFAM
Pfam:SVS_QK 139 149 1.3e-5 PFAM
Pfam:SVS_QK 151 166 8.4e-4 PFAM
Pfam:SVS_QK 168 179 5.3e-6 PFAM
Pfam:SVS_QK 180 195 3.9e-3 PFAM
Pfam:SVS_QK 197 207 1.3e-5 PFAM
Pfam:SVS_QK 210 221 8.8e-5 PFAM
Pfam:SVS_QK 225 236 7.7e-6 PFAM
Pfam:SVS_QK 238 249 6.1e-6 PFAM
Pfam:SVS_QK 249 260 5.2e-4 PFAM
Pfam:SVS_QK 262 272 3.1e-5 PFAM
Pfam:SVS_QK 323 334 6.7e-5 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000109374
AA Change: K106R

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000104999
Gene: ENSMUSG00000040132
AA Change: K106R

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:SVS_QK 110 121 1.2e-6 PFAM
Pfam:SVS_QK 122 137 3.9e-3 PFAM
Pfam:SVS_QK 139 149 1.3e-5 PFAM
Pfam:SVS_QK 151 166 8.4e-4 PFAM
Pfam:SVS_QK 168 179 5.3e-6 PFAM
Pfam:SVS_QK 180 195 3.9e-3 PFAM
Pfam:SVS_QK 197 207 1.3e-5 PFAM
Pfam:SVS_QK 210 221 8.8e-5 PFAM
Pfam:SVS_QK 225 236 7.7e-6 PFAM
Pfam:SVS_QK 238 249 6.1e-6 PFAM
Pfam:SVS_QK 249 260 5.2e-4 PFAM
Pfam:SVS_QK 262 272 3.1e-5 PFAM
Pfam:SVS_QK 323 334 6.7e-5 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T A 3: 121,847,910 (GRCm39) M77K probably benign Het
Amy1 A G 3: 113,349,769 (GRCm39) V467A probably damaging Het
Atf4 T C 15: 80,140,531 (GRCm39) V11A possibly damaging Het
B4galt1 T C 4: 40,807,268 (GRCm39) N373D probably damaging Het
Bpifa3 A G 2: 153,977,498 (GRCm39) K112R probably damaging Het
Chd2 T A 7: 73,141,105 (GRCm39) Y596F possibly damaging Het
Clspn T C 4: 126,472,211 (GRCm39) S962P probably damaging Het
Cyp2c68 T C 19: 39,722,762 (GRCm39) D262G possibly damaging Het
Dcaf11 T C 14: 55,803,152 (GRCm39) I282T probably damaging Het
Dmxl1 T C 18: 50,090,462 (GRCm39) probably null Het
Dnah11 T G 12: 117,987,670 (GRCm39) K2411Q probably damaging Het
Elf3 A G 1: 135,184,220 (GRCm39) V196A probably benign Het
Fhad1 T G 4: 141,681,427 (GRCm39) T538P probably damaging Het
Fkbp10 A G 11: 100,311,849 (GRCm39) D174G probably damaging Het
Gas6 A G 8: 13,527,098 (GRCm39) S217P probably damaging Het
Heatr5b C T 17: 79,074,304 (GRCm39) probably null Het
Iqgap3 A G 3: 88,023,215 (GRCm39) E502G probably benign Het
Klc1 T C 12: 111,762,061 (GRCm39) V577A possibly damaging Het
Lck T C 4: 129,445,431 (GRCm39) probably null Het
Mc3r C A 2: 172,091,610 (GRCm39) Y277* probably null Het
Mlxipl T C 5: 135,162,458 (GRCm39) V640A probably benign Het
Mrc2 A T 11: 105,223,169 (GRCm39) N471Y probably damaging Het
Ncan T A 8: 70,554,667 (GRCm39) H1050L probably damaging Het
Nrl C A 14: 55,759,889 (GRCm39) V13F probably damaging Het
Obscn T A 11: 58,967,082 (GRCm39) Y546F probably damaging Het
Or52u1 T G 7: 104,237,097 (GRCm39) S46A probably benign Het
Or6c209 A G 10: 129,483,960 (GRCm39) probably null Het
Or6d14 A G 6: 116,534,074 (GRCm39) I229M probably damaging Het
Pde3b G A 7: 114,120,927 (GRCm39) G684D probably damaging Het
Prkaa1 C T 15: 5,203,823 (GRCm39) T244I probably benign Het
Scfd2 A T 5: 74,367,059 (GRCm39) probably null Het
Slc22a30 G A 19: 8,321,757 (GRCm39) Q436* probably null Het
Smg1 A T 7: 117,744,813 (GRCm39) V3113D possibly damaging Het
Sorbs1 T C 19: 40,365,325 (GRCm39) T153A probably benign Het
Spag16 A G 1: 69,909,448 (GRCm39) T182A probably benign Het
Spopfm1 T A 3: 94,173,959 (GRCm39) H322Q possibly damaging Het
Tenm1 A G X: 42,163,572 (GRCm39) V107A possibly damaging Het
Topaz1 A T 9: 122,628,550 (GRCm39) I1546F possibly damaging Het
Tubgcp2 C A 7: 139,612,138 (GRCm39) E78* probably null Het
Vars1 A G 17: 35,224,457 (GRCm39) probably null Het
Vmn2r109 A T 17: 20,774,567 (GRCm39) W263R probably benign Het
Other mutations in Svs5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Svs5 APN 2 164,078,962 (GRCm39) missense possibly damaging 0.86
IGL01722:Svs5 APN 2 164,079,446 (GRCm39) missense possibly damaging 0.71
IGL03189:Svs5 APN 2 164,079,032 (GRCm39) missense possibly damaging 0.73
IGL03378:Svs5 APN 2 164,175,260 (GRCm39) missense probably benign 0.00
R0781:Svs5 UTSW 2 164,175,507 (GRCm39) missense probably benign 0.16
R1110:Svs5 UTSW 2 164,175,507 (GRCm39) missense probably benign 0.16
R1276:Svs5 UTSW 2 164,079,168 (GRCm39) missense possibly damaging 0.95
R1541:Svs5 UTSW 2 164,078,929 (GRCm39) missense possibly damaging 0.71
R1590:Svs5 UTSW 2 164,079,578 (GRCm39) missense possibly damaging 0.86
R3103:Svs5 UTSW 2 164,175,313 (GRCm39) missense probably benign 0.00
R3946:Svs5 UTSW 2 164,079,047 (GRCm39) missense probably benign 0.01
R3965:Svs5 UTSW 2 164,079,662 (GRCm39) missense possibly damaging 0.53
R4075:Svs5 UTSW 2 164,079,238 (GRCm39) missense probably benign 0.01
R4632:Svs5 UTSW 2 164,079,667 (GRCm39) missense probably benign 0.40
R4732:Svs5 UTSW 2 164,079,043 (GRCm39) missense possibly damaging 0.87
R4733:Svs5 UTSW 2 164,079,043 (GRCm39) missense possibly damaging 0.87
R4839:Svs5 UTSW 2 164,078,806 (GRCm39) missense probably benign 0.40
R6936:Svs5 UTSW 2 164,079,548 (GRCm39) missense possibly damaging 0.86
R7052:Svs5 UTSW 2 164,080,126 (GRCm39) missense unknown
R7338:Svs5 UTSW 2 164,174,728 (GRCm39) missense possibly damaging 0.96
R7836:Svs5 UTSW 2 164,079,500 (GRCm39) missense possibly damaging 0.86
R8017:Svs5 UTSW 2 164,175,341 (GRCm39) missense possibly damaging 0.86
R8019:Svs5 UTSW 2 164,175,341 (GRCm39) missense possibly damaging 0.86
R8035:Svs5 UTSW 2 164,079,053 (GRCm39) missense probably benign 0.18
R8100:Svs5 UTSW 2 164,079,712 (GRCm39) missense probably benign 0.08
R8187:Svs5 UTSW 2 164,079,692 (GRCm39) missense possibly damaging 0.88
R8310:Svs5 UTSW 2 164,080,091 (GRCm39) missense probably damaging 1.00
R8312:Svs5 UTSW 2 164,080,091 (GRCm39) missense probably damaging 1.00
R9089:Svs5 UTSW 2 164,079,341 (GRCm39) missense probably benign 0.27
R9156:Svs5 UTSW 2 164,079,509 (GRCm39) missense probably benign 0.32
R9545:Svs5 UTSW 2 164,079,313 (GRCm39) missense possibly damaging 0.52
R9790:Svs5 UTSW 2 164,078,918 (GRCm39) nonsense probably null
R9791:Svs5 UTSW 2 164,078,918 (GRCm39) nonsense probably null
Z1176:Svs5 UTSW 2 164,174,711 (GRCm39) missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- TTGTCCAAAGGCTGGTCCTC -3'
(R):5'- AAAGGCCACTTCCAGAGCAG -3'

Sequencing Primer
(F):5'- GGTCCTCCAGATTTCAACTGAC -3'
(R):5'- AGAAAGGCCGTCTCAGTTTC -3'
Posted On 2017-01-03