Mutagenetix > Incidental Mutation

Incidental Mutation 'R0551:Ppara'

45196

Institutional Source

Beutler Lab

Gene Symbol

Ppara

Ensembl Gene

ENSMUSG00000022383

Gene Name

peroxisome proliferator activated receptor alpha

Synonyms

Ppar, Nr1c1, PPAR-alpha, PPARalpha, 4933429D07Rik

MMRRC Submission

038743-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0551 (G1)

Quality Score

219

Status

Validated

Chromosome

Chromosomal Location

85734983-85802819 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to C at 85787105 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000105050 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000057979] [ENSMUST00000109422] [ENSMUST00000109423]

AlphaFold

P23204

Predicted Effect

probably benign
Transcript: ENSMUST00000057979

SMART Domains

Protein: ENSMUSP00000059719
Gene: ENSMUSG00000022383

Domain	Start	End	E-Value	Type
low complexity region	34	51	N/A	INTRINSIC
low complexity region	73	89	N/A	INTRINSIC
ZnF_C4	99	169	2.27e-34	SMART
HOLI	278	437	2.8e-25	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000109422

SMART Domains

Protein: ENSMUSP00000105049
Gene: ENSMUSG00000022383

Domain	Start	End	E-Value	Type
low complexity region	34	51	N/A	INTRINSIC
low complexity region	73	89	N/A	INTRINSIC
ZnF_C4	99	169	2.27e-34	SMART
HOLI	278	437	2.8e-25	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000109423

SMART Domains

Protein: ENSMUSP00000105050
Gene: ENSMUSG00000022383

Domain	Start	End	E-Value	Type
low complexity region	34	51	N/A	INTRINSIC
low complexity region	73	89	N/A	INTRINSIC
ZnF_C4	99	169	2.27e-34	SMART
HOLI	278	437	2.8e-25	SMART

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.1%
20x: 95.1%

Validation Efficiency

99% (77/78)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Peroxisome proliferators include hypolipidemic drugs, herbicides, leukotriene antagonists, and plasticizers; this term arises because they induce an increase in the size and number of peroxisomes. Peroxisomes are subcellular organelles found in plants and animals that contain enzymes for respiration and for cholesterol and lipid metabolism. The action of peroxisome proliferators is thought to be mediated via specific receptors, called PPARs, which belong to the steroid hormone receptor superfamily. PPARs affect the expression of target genes involved in cell proliferation, cell differentiation and in immune and inflammation responses. Three closely related subtypes (alpha, beta/delta, and gamma) have been identified. This gene encodes the subtype PPAR-alpha, which is a nuclear transcription factor. Multiple alternatively spliced transcript variants have been described for this gene, although the full-length nature of only two has been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit loss of diurnal variation in hepatic fatty acid and cholesterol synthesis, increased hepatic lipid and gonadal adipose stores, impaired skin wound healing, and altered metabolic responses to starvation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3425401B19Rik	T	A	14: 32,662,641	T456S	probably benign	Het
5830473C10Rik	C	T	5: 90,572,719	P250S	probably damaging	Het
Acmsd	A	T	1: 127,766,333	K333N	probably benign	Het
Adcy2	T	A	13: 68,796,539	K241N	probably damaging	Het
Aebp1	A	G	11: 5,867,955	I77V	probably benign	Het
Ankrd35	A	G	3: 96,683,960	T521A	probably benign	Het
Arap2	C	T	5: 62,641,323		probably null	Het
Arfgap3	A	T	15: 83,343,137	C25S	probably damaging	Het
Arhgap20	T	A	9: 51,825,825		probably benign	Het
Arhgap39	C	T	15: 76,734,886	D833N	probably damaging	Het
Auts2	T	C	5: 131,440,469	E446G	possibly damaging	Het
Brwd1	C	T	16: 96,035,974	R886H	probably damaging	Het
Carm1	G	A	9: 21,580,491		probably null	Het
Cdc5l	G	A	17: 45,415,684	R321W	probably damaging	Het
Cfap54	A	T	10: 93,025,122	M841K	probably benign	Het
Clca4b	T	A	3: 144,928,626	T69S	probably damaging	Het
Cpox	A	G	16: 58,675,390	I357V	probably benign	Het
Diaph3	C	A	14: 86,910,100	V711L	probably benign	Het
Fabp3-ps1	T	C	10: 86,732,040		probably benign	Het
Fam120b	A	T	17: 15,431,643		probably benign	Het
Fcho1	A	G	8: 71,712,174	S488P	probably benign	Het
Flcn	A	G	11: 59,795,748		probably null	Het
Flt3l	A	G	7: 45,132,266	W234R	probably damaging	Het
Fzd7	G	T	1: 59,483,284	V109L	probably damaging	Het
G3bp1	A	G	11: 55,489,143	N101S	probably benign	Het
Gadd45g	A	G	13: 51,847,927	E143G	probably damaging	Het
Ganab	T	G	19: 8,907,280	I149S	probably benign	Het
Garnl3	A	G	2: 33,016,738	S413P	probably damaging	Het
Glis1	C	T	4: 107,568,119		probably null	Het
Gm11563	A	G	11: 99,658,713	S72P	unknown	Het
Gpd1	T	G	15: 99,720,629	I188S	possibly damaging	Het
Gria2	A	G	3: 80,732,026		probably benign	Het
H2afy2	A	G	10: 61,741,166	S308P	probably damaging	Het
Hpcal4	G	T	4: 123,189,055	A65S	possibly damaging	Het
Igsf10	G	A	3: 59,328,668	T1364I	probably benign	Het
Kdm4a	T	C	4: 118,138,231	*1065W	probably null	Het
Klkb1	A	G	8: 45,277,966		probably null	Het
Lipo3	T	C	19: 33,580,551	D147G	probably damaging	Het
Lrp1	A	G	10: 127,571,958	S1821P	probably benign	Het
Manba	T	C	3: 135,517,973	I207T	probably damaging	Het
Mark3	T	A	12: 111,633,634	S428T	probably benign	Het
Mfsd4a	G	A	1: 132,041,919	T348I	probably damaging	Het
Mfsd7a	A	G	5: 108,444,465		probably benign	Het
Mybbp1a	A	G	11: 72,448,376	M880V	probably benign	Het
N4bp2	T	A	5: 65,820,341		probably null	Het
Nrd1	T	G	4: 109,047,708	I712S	probably damaging	Het
Nup210	G	A	6: 91,021,484	R774C	possibly damaging	Het
Obscn	G	A	11: 59,107,862	R1395*	probably null	Het
Olfr1454	T	A	19: 13,064,294	D294E	probably benign	Het
Pcdh7	T	C	5: 57,721,994	Y964H	probably damaging	Het
Plin4	T	C	17: 56,106,756	T290A	probably benign	Het
Psg21	T	G	7: 18,652,640		probably null	Het
Ptar1	C	A	19: 23,720,340	N405K	probably benign	Het
Ralgps2	A	G	1: 156,832,663		probably null	Het
Rnf6	T	A	5: 146,211,395	N271I	possibly damaging	Het
Sis	T	C	3: 72,925,407	D1019G	possibly damaging	Het
Slc37a3	A	G	6: 39,352,754		probably benign	Het
Slc6a12	G	A	6: 121,356,918	V238I	probably damaging	Het
Sntg1	C	A	1: 8,554,736	V279L	possibly damaging	Het
Sorbs1	T	A	19: 40,311,816	E567D	probably damaging	Het
Sp110	C	A	1: 85,589,100		probably benign	Het
Ssu2	A	G	6: 112,380,554	V175A	possibly damaging	Het
Stk36	G	A	1: 74,616,621	E428K	probably benign	Het
Teddm1b	A	T	1: 153,875,344	I300F	possibly damaging	Het
Thy1	T	C	9: 44,047,348	V129A	probably damaging	Het
Tiam2	T	A	17: 3,428,954	M654K	probably damaging	Het
Tmem69	T	C	4: 116,553,273	S167G	probably benign	Het
Tmem8	C	A	17: 26,120,602	Q605K	probably damaging	Het
Tmem81	C	G	1: 132,507,829	I124M	probably damaging	Het
Tspan10	A	G	11: 120,444,418	D118G	probably damaging	Het
Tspo2	A	G	17: 48,448,813		probably benign	Het
Ttn	G	A	2: 76,908,328	Q4002*	probably null	Het
Tyro3	G	A	2: 119,816,904	R834Q	probably damaging	Het
Ugt2b1	T	C	5: 86,926,084	K139E	probably benign	Het
Vmn1r9	A	T	6: 57,071,539	I200F	probably benign	Het

Other mutations in Ppara

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00417:Ppara	APN	15	85801067	missense	probably benign	0.00
IGL00754:Ppara	APN	15	85777642	missense	probably damaging	0.99
IGL01409:Ppara	APN	15	85777643	missense	probably damaging	0.98
IGL02080:Ppara	APN	15	85789019	missense	possibly damaging	0.74
IGL02442:Ppara	APN	15	85801143	missense	probably benign	0.19
IGL02810:Ppara	APN	15	85777677	missense	probably damaging	0.99
IGL02852:Ppara	APN	15	85797878	missense	probably benign	0.00
R0333:Ppara	UTSW	15	85790960	missense	probably damaging	1.00
R0883:Ppara	UTSW	15	85798171	missense	probably damaging	1.00
R1125:Ppara	UTSW	15	85789055	missense	possibly damaging	0.71
R1189:Ppara	UTSW	15	85798164	missense	probably benign	0.04
R1233:Ppara	UTSW	15	85798021	missense	probably damaging	1.00
R1582:Ppara	UTSW	15	85798228	missense	possibly damaging	0.69
R1755:Ppara	UTSW	15	85797979	missense	probably benign	0.14
R1913:Ppara	UTSW	15	85801099	missense	probably damaging	1.00
R2163:Ppara	UTSW	15	85801046	missense	probably benign	0.04
R4570:Ppara	UTSW	15	85787197	missense	probably benign	0.02
R4980:Ppara	UTSW	15	85787233	missense	probably damaging	0.99
R5117:Ppara	UTSW	15	85777761	missense	probably benign	0.00
R5749:Ppara	UTSW	15	85789028	missense	probably benign	0.35
R6199:Ppara	UTSW	15	85787233	missense	probably damaging	0.99
R6221:Ppara	UTSW	15	85777680	missense	probably benign	0.02
R6624:Ppara	UTSW	15	85791036	missense	probably benign	0.24
R7382:Ppara	UTSW	15	85787228	missense	probably damaging	1.00
R7534:Ppara	UTSW	15	85777726	missense	probably benign
R7629:Ppara	UTSW	15	85798191	missense	probably damaging	0.98
R8171:Ppara	UTSW	15	85797876	missense	probably benign
R8848:Ppara	UTSW	15	85788987	missense	possibly damaging	0.93
R9378:Ppara	UTSW	15	85777636	missense	possibly damaging	0.62

Predicted Primers

PCR Primer
(F):5'- TGAGCCTCAAGAATGGTGGCAC -3'
(R):5'- ACTGTCAGAAGGGGAGTCAACCTG -3'

Sequencing Primer
(F):5'- TGGTGGCACCATGATAAGTAACC -3'
(R):5'- ACAGAAGCCAGTTCTCTGCTC -3'

Posted On

2013-06-11