Mutagenetix > Incidental Mutations

Incidental Mutation 'R5706:Iqgap3'

451960

Institutional Source

Beutler Lab

Gene Symbol

Iqgap3

Ensembl Gene

ENSMUSG00000028068

Gene Name

IQ motif containing GTPase activating protein 3

Synonyms

MMRRC Submission

043331-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.335) question?

Stock #

R5706 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

88081971-88121048 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 88115908 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 502 (E502G)

Ref Sequence

ENSEMBL: ENSMUSP00000142035 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071812] [ENSMUST00000194440]

AlphaFold

F8VQ29

Predicted Effect

probably benign
Transcript: ENSMUST00000071812
AA Change: E1400G

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000071715
Gene: ENSMUSG00000028068
AA Change: E1400G

Domain	Start	End	E-Value	Type
CH	36	145	1.72e-14	SMART
internal_repeat_2	197	249	1.75e-5	PROSPERO
internal_repeat_1	209	418	1.31e-14	PROSPERO
low complexity region	419	438	N/A	INTRINSIC
internal_repeat_1	446	651	1.31e-14	PROSPERO
internal_repeat_2	600	652	1.75e-5	PROSPERO
IQ	730	752	1.18e1	SMART
IQ	760	782	3.76e-6	SMART
IQ	790	812	3.08e-2	SMART
IQ	820	842	1.72e0	SMART
RasGAP	977	1330	1.74e-57	SMART
Blast:RasGAP	1338	1422	1e-9	BLAST
Pfam:RasGAP_C	1434	1555	2e-36	PFAM
low complexity region	1591	1602	N/A	INTRINSIC
low complexity region	1615	1630	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000194440
AA Change: E502G

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000142035
Gene: ENSMUSG00000028068
AA Change: E502G

Domain	Start	End	E-Value	Type
Blast:RasGAP	1	67	3e-30	BLAST
RasGAP	79	432	1e-59	SMART
Blast:RasGAP	440	524	5e-10	BLAST
Pfam:RasGAP_C	535	660	5.7e-30	PFAM
low complexity region	693	704	N/A	INTRINSIC
low complexity region	717	732	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000194772

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 95.1%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca4	T	A	3: 122,054,261	M77K	probably benign	Het
Amy1	A	G	3: 113,556,120	V467A	probably damaging	Het
Atf4	T	C	15: 80,256,330	V11A	possibly damaging	Het
B4galt1	T	C	4: 40,807,268	N373D	probably damaging	Het
Bpifa3	A	G	2: 154,135,578	K112R	probably damaging	Het
Chd2	T	A	7: 73,491,357	Y596F	possibly damaging	Het
Clspn	T	C	4: 126,578,418	S962P	probably damaging	Het
Cyp2c68	T	C	19: 39,734,318	D262G	possibly damaging	Het
Dcaf11	T	C	14: 55,565,695	I282T	probably damaging	Het
Dmxl1	T	C	18: 49,957,395		probably null	Het
Dnah11	T	G	12: 118,023,935	K2411Q	probably damaging	Het
Elf3	A	G	1: 135,256,482	V196A	probably benign	Het
Fhad1	T	G	4: 141,954,116	T538P	probably damaging	Het
Fkbp10	A	G	11: 100,421,023	D174G	probably damaging	Het
Gas6	A	G	8: 13,477,098	S217P	probably damaging	Het
Gm4778	T	A	3: 94,266,652	H322Q	possibly damaging	Het
Heatr5b	C	T	17: 78,766,875		probably null	Het
Klc1	T	C	12: 111,795,627	V577A	possibly damaging	Het
Lck	T	C	4: 129,551,638		probably null	Het
Mc3r	C	A	2: 172,249,690	Y277*	probably null	Het
Mlxipl	T	C	5: 135,133,604	V640A	probably benign	Het
Mrc2	A	T	11: 105,332,343	N471Y	probably damaging	Het
Ncan	T	A	8: 70,102,017	H1050L	probably damaging	Het
Nrl	C	A	14: 55,522,432	V13F	probably damaging	Het
Obscn	T	A	11: 59,076,256	Y546F	probably damaging	Het
Olfr214	A	G	6: 116,557,113	I229M	probably damaging	Het
Olfr654	T	G	7: 104,587,890	S46A	probably benign	Het
Olfr799	A	G	10: 129,648,091		probably null	Het
Pde3b	G	A	7: 114,521,692	G684D	probably damaging	Het
Prkaa1	C	T	15: 5,174,342	T244I	probably benign	Het
Scfd2	A	T	5: 74,206,398		probably null	Het
Slc22a30	G	A	19: 8,344,393	Q436*	probably null	Het
Smg1	A	T	7: 118,145,590	V3113D	possibly damaging	Het
Sorbs1	T	C	19: 40,376,881	T153A	probably benign	Het
Spag16	A	G	1: 69,870,289	T182A	probably benign	Het
Svs2	T	C	2: 164,237,669	K106R	possibly damaging	Het
Tenm1	A	G	X: 43,074,695	V107A	possibly damaging	Het
Topaz1	A	T	9: 122,799,485	I1546F	possibly damaging	Het
Tubgcp2	C	A	7: 140,032,225	E78*	probably null	Het
Vars	A	G	17: 35,005,481		probably null	Het
Vmn2r109	A	T	17: 20,554,305	W263R	probably benign	Het

Other mutations in Iqgap3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01016:Iqgap3	APN	3	88107560	missense	probably damaging	1.00
IGL01062:Iqgap3	APN	3	88110122	missense	probably benign	0.00
IGL01517:Iqgap3	APN	3	88109396	missense	probably benign	0.09
IGL01530:Iqgap3	APN	3	88112303	critical splice acceptor site	probably null
IGL01658:Iqgap3	APN	3	88115971	missense	possibly damaging	0.89
IGL02027:Iqgap3	APN	3	88087342	missense	possibly damaging	0.67
IGL02352:Iqgap3	APN	3	88101960	missense	probably benign	0.00
IGL02359:Iqgap3	APN	3	88101960	missense	probably benign	0.00
IGL02522:Iqgap3	APN	3	88108398	missense	possibly damaging	0.94
IGL02717:Iqgap3	APN	3	88098359	missense	probably benign	0.01
IGL02971:Iqgap3	APN	3	88090304	missense	probably benign	0.30
IGL03079:Iqgap3	APN	3	88113170	missense	probably benign
IGL03240:Iqgap3	APN	3	88114974	missense	probably benign	0.00
adjutant	UTSW	3	88101527	missense	possibly damaging	0.51
Booster	UTSW	3	88113128	missense	probably damaging	0.99
peso_ligero	UTSW	3	88112771	frame shift	probably null
R0048:Iqgap3	UTSW	3	88115949	missense	probably benign	0.00
R0048:Iqgap3	UTSW	3	88115949	missense	probably benign	0.00
R0285:Iqgap3	UTSW	3	88096990	missense	probably benign	0.11
R0442:Iqgap3	UTSW	3	88115959	missense	probably damaging	0.96
R0490:Iqgap3	UTSW	3	88114056	splice site	probably benign
R0569:Iqgap3	UTSW	3	88090725	splice site	probably benign
R0747:Iqgap3	UTSW	3	88107503	splice site	probably benign
R0843:Iqgap3	UTSW	3	88108431	missense	possibly damaging	0.94
R1260:Iqgap3	UTSW	3	88114023	missense	probably benign
R1465:Iqgap3	UTSW	3	88087309	missense	probably damaging	0.99
R1465:Iqgap3	UTSW	3	88087309	missense	probably damaging	0.99
R1544:Iqgap3	UTSW	3	88098893	missense	probably benign	0.00
R1662:Iqgap3	UTSW	3	88098401	missense	probably benign	0.33
R1686:Iqgap3	UTSW	3	88108356	splice site	probably benign
R1748:Iqgap3	UTSW	3	88113980	missense	possibly damaging	0.92
R1836:Iqgap3	UTSW	3	88108368	missense	probably damaging	1.00
R1972:Iqgap3	UTSW	3	88083928	splice site	probably null
R1973:Iqgap3	UTSW	3	88083928	splice site	probably null
R2051:Iqgap3	UTSW	3	88120167	missense	probably damaging	1.00
R2314:Iqgap3	UTSW	3	88116031	missense	probably benign	0.01
R2352:Iqgap3	UTSW	3	88104508	missense	possibly damaging	0.94
R2857:Iqgap3	UTSW	3	88107596	nonsense	probably null
R2859:Iqgap3	UTSW	3	88107596	nonsense	probably null
R3435:Iqgap3	UTSW	3	88094604	missense	probably benign	0.00
R3522:Iqgap3	UTSW	3	88090782	missense	probably null	0.90
R4281:Iqgap3	UTSW	3	88098860	missense	probably benign	0.19
R4283:Iqgap3	UTSW	3	88098860	missense	probably benign	0.19
R4397:Iqgap3	UTSW	3	88104358	missense	probably damaging	1.00
R4414:Iqgap3	UTSW	3	88096986	missense	probably benign
R4660:Iqgap3	UTSW	3	88120176	missense	probably damaging	1.00
R4872:Iqgap3	UTSW	3	88113128	missense	probably damaging	0.99
R4883:Iqgap3	UTSW	3	88107535	missense	probably benign
R4915:Iqgap3	UTSW	3	88101527	missense	possibly damaging	0.51
R5050:Iqgap3	UTSW	3	88090186	missense	probably damaging	1.00
R5130:Iqgap3	UTSW	3	88108854	missense	probably damaging	0.97
R5151:Iqgap3	UTSW	3	88117760	missense	possibly damaging	0.58
R5645:Iqgap3	UTSW	3	88117699	missense	probably damaging	1.00
R5748:Iqgap3	UTSW	3	88109370	missense	probably damaging	1.00
R5880:Iqgap3	UTSW	3	88117202	missense	possibly damaging	0.67
R5982:Iqgap3	UTSW	3	88091592	nonsense	probably null
R6006:Iqgap3	UTSW	3	88091547	missense	probably damaging	0.98
R6026:Iqgap3	UTSW	3	88090171	missense	probably damaging	1.00
R6188:Iqgap3	UTSW	3	88098893	missense	probably benign	0.00
R6211:Iqgap3	UTSW	3	88091515	missense	probably benign
R6291:Iqgap3	UTSW	3	88089730	critical splice donor site	probably null
R6344:Iqgap3	UTSW	3	88082094	critical splice donor site	probably null
R6854:Iqgap3	UTSW	3	88096951	missense	probably damaging	1.00
R6875:Iqgap3	UTSW	3	88112771	frame shift	probably null
R6877:Iqgap3	UTSW	3	88112771	frame shift	probably null
R6958:Iqgap3	UTSW	3	88113366	missense	possibly damaging	0.89
R7008:Iqgap3	UTSW	3	88112771	frame shift	probably null
R7050:Iqgap3	UTSW	3	88098913	missense	probably damaging	1.00
R7144:Iqgap3	UTSW	3	88116910	missense	probably damaging	1.00
R7170:Iqgap3	UTSW	3	88102063	missense	probably damaging	1.00
R7288:Iqgap3	UTSW	3	88108835	missense	probably damaging	1.00
R7952:Iqgap3	UTSW	3	88098370	missense	probably benign
R8008:Iqgap3	UTSW	3	88109463	missense	probably damaging	0.98
R8049:Iqgap3	UTSW	3	88104302	missense	probably damaging	1.00
R8176:Iqgap3	UTSW	3	88094650	missense	probably damaging	0.96
R8190:Iqgap3	UTSW	3	88090779	missense	probably damaging	0.98
R8772:Iqgap3	UTSW	3	88089837	missense	probably benign	0.05
R8878:Iqgap3	UTSW	3	88113225	missense	probably damaging	1.00
R8893:Iqgap3	UTSW	3	88089886	missense	probably damaging	1.00
R9072:Iqgap3	UTSW	3	88109466	missense
R9073:Iqgap3	UTSW	3	88109466	missense
Z1177:Iqgap3	UTSW	3	88088971	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- GGCCACCATAGATGATCCTTAAGAC -3'
(R):5'- AAGTCCCTGGTAGCAGTCAC -3'

Sequencing Primer
(F):5'- CCTCCCGAGTACTGGGATTAAAG -3'
(R):5'- TAGCAGTCACTGGCCCTGAC -3'

Posted On

2017-01-03