Incidental Mutation 'R5706:B4galt1'
ID451964
Institutional Source Beutler Lab
Gene Symbol B4galt1
Ensembl Gene ENSMUSG00000028413
Gene NameUDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1
SynonymsGalT, Ggtb, beta 1,4-Galactosyltransferase I, Ggtb2, beta-1,4-GalT1, b1,4-Galactosyltransferase I, B-1,4-GalT1
MMRRC Submission 043331-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5706 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location40804602-40854005 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 40807268 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 373 (N373D)
Ref Sequence ENSEMBL: ENSMUSP00000030121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030121] [ENSMUST00000108096]
Predicted Effect probably damaging
Transcript: ENSMUST00000030121
AA Change: N373D

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000030121
Gene: ENSMUSG00000028413
AA Change: N373D

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
low complexity region 73 89 N/A INTRINSIC
Pfam:Glyco_transf_7N 131 264 3.1e-62 PFAM
Pfam:Glyco_transf_7C 268 346 5.9e-32 PFAM
Pfam:Glyco_tranf_2_2 279 339 4.1e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108096
SMART Domains Protein: ENSMUSP00000103731
Gene: ENSMUSG00000028413

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
low complexity region 73 89 N/A INTRINSIC
Pfam:Glyco_transf_7N 131 266 1.8e-52 PFAM
Pfam:Glyco_transf_7C 268 328 8.7e-26 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes two distinct enzyme isoforms, a long membrane-bound form and a short soluble form. These alternate isoforms are thought to be produced through alternative nested transcription initiation and different in-frame start codon usage. These enzymes catalyze the transfer of galactose to acceptor sugars, such as N-acetylglucosamine and glucose. The long form of this enzyme is localized to the trans-Golgi membrane and is involved in glycoconjugate biosynthesis. The short form functions in lactose biosynthesis though formation of a heterodimer with alpha-lactalbumin. [provided by RefSeq, Nov 2012]
PHENOTYPE: Homozygotes for targeted null mutations exhibit growth retardation, low viability, excessive epithelial cell proliferation of skin and small intestine, sperm with reduced fertilizing capacity, birthing difficulty, and mammary gland defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T A 3: 122,054,261 M77K probably benign Het
Amy1 A G 3: 113,556,120 V467A probably damaging Het
Atf4 T C 15: 80,256,330 V11A possibly damaging Het
Bpifa3 A G 2: 154,135,578 K112R probably damaging Het
Chd2 T A 7: 73,491,357 Y596F possibly damaging Het
Clspn T C 4: 126,578,418 S962P probably damaging Het
Cyp2c68 T C 19: 39,734,318 D262G possibly damaging Het
Dcaf11 T C 14: 55,565,695 I282T probably damaging Het
Dmxl1 T C 18: 49,957,395 probably null Het
Dnah11 T G 12: 118,023,935 K2411Q probably damaging Het
Elf3 A G 1: 135,256,482 V196A probably benign Het
Fhad1 T G 4: 141,954,116 T538P probably damaging Het
Fkbp10 A G 11: 100,421,023 D174G probably damaging Het
Gas6 A G 8: 13,477,098 S217P probably damaging Het
Gm4778 T A 3: 94,266,652 H322Q possibly damaging Het
Heatr5b C T 17: 78,766,875 probably null Het
Iqgap3 A G 3: 88,115,908 E502G probably benign Het
Klc1 T C 12: 111,795,627 V577A possibly damaging Het
Lck T C 4: 129,551,638 probably null Het
Mc3r C A 2: 172,249,690 Y277* probably null Het
Mlxipl T C 5: 135,133,604 V640A probably benign Het
Mrc2 A T 11: 105,332,343 N471Y probably damaging Het
Ncan T A 8: 70,102,017 H1050L probably damaging Het
Nrl C A 14: 55,522,432 V13F probably damaging Het
Obscn T A 11: 59,076,256 Y546F probably damaging Het
Olfr214 A G 6: 116,557,113 I229M probably damaging Het
Olfr654 T G 7: 104,587,890 S46A probably benign Het
Olfr799 A G 10: 129,648,091 probably null Het
Pde3b G A 7: 114,521,692 G684D probably damaging Het
Prkaa1 C T 15: 5,174,342 T244I probably benign Het
Scfd2 A T 5: 74,206,398 probably null Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Smg1 A T 7: 118,145,590 V3113D possibly damaging Het
Sorbs1 T C 19: 40,376,881 T153A probably benign Het
Spag16 A G 1: 69,870,289 T182A probably benign Het
Svs2 T C 2: 164,237,669 K106R possibly damaging Het
Tenm1 A G X: 43,074,695 V107A possibly damaging Het
Topaz1 A T 9: 122,799,485 I1546F possibly damaging Het
Tubgcp2 C A 7: 140,032,225 E78* probably null Het
Vars A G 17: 35,005,481 probably null Het
Vmn2r109 A T 17: 20,554,305 W263R probably benign Het
Other mutations in B4galt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01795:B4galt1 APN 4 40807760 missense probably damaging 1.00
periwinkle UTSW 4 40807760 missense probably damaging 1.00
R1589:B4galt1 UTSW 4 40823575 missense probably benign 0.28
R3797:B4galt1 UTSW 4 40807258 missense probably benign 0.12
R4419:B4galt1 UTSW 4 40853537 missense probably benign
R4703:B4galt1 UTSW 4 40823569 missense probably benign 0.14
R4727:B4galt1 UTSW 4 40807812 missense probably damaging 1.00
R5903:B4galt1 UTSW 4 40807760 missense probably damaging 1.00
R6860:B4galt1 UTSW 4 40807796 missense probably benign 0.00
R6878:B4galt1 UTSW 4 40809694 missense probably damaging 1.00
R6943:B4galt1 UTSW 4 40812860 missense probably benign 0.00
R7239:B4galt1 UTSW 4 40812754 missense probably damaging 1.00
R7479:B4galt1 UTSW 4 40823587 missense probably damaging 1.00
R7792:B4galt1 UTSW 4 40809373 missense probably benign 0.00
R7887:B4galt1 UTSW 4 40823501 missense probably benign 0.08
R7970:B4galt1 UTSW 4 40823501 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- TCTGGAGGGACGTCTGAATG -3'
(R):5'- GGCCCTTTAACTCCAGTGAAGTAG -3'

Sequencing Primer
(F):5'- TCATTCAGACTGTACAAATGAGAGG -3'
(R):5'- GTAGAGATATTCCATCTGGGGTAAC -3'
Posted On2017-01-03