Incidental Mutation 'R5706:Lck'
ID 451967
Institutional Source Beutler Lab
Gene Symbol Lck
Ensembl Gene ENSMUSG00000000409
Gene Name lymphocyte protein tyrosine kinase
Synonyms Hck-3, p56
MMRRC Submission 043331-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5706 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 129548344-129573641 bp(-) (GRCm38)
Type of Mutation critical splice acceptor site
DNA Base Change (assembly) T to C at 129551638 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125777 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067240] [ENSMUST00000102596] [ENSMUST00000167288] [ENSMUST00000167288]
AlphaFold P06240
Predicted Effect probably null
Transcript: ENSMUST00000067240
SMART Domains Protein: ENSMUSP00000066209
Gene: ENSMUSG00000000409

DomainStartEndE-ValueType
SH3 64 120 3.53e-17 SMART
SH2 125 215 2.07e-34 SMART
TyrKc 245 494 2.66e-133 SMART
Predicted Effect probably null
Transcript: ENSMUST00000102596
SMART Domains Protein: ENSMUSP00000099656
Gene: ENSMUSG00000000409

DomainStartEndE-ValueType
SH3 64 120 3.53e-17 SMART
SH2 125 215 2.07e-34 SMART
TyrKc 245 494 2.66e-133 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123640
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127943
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132030
Predicted Effect probably null
Transcript: ENSMUST00000167288
SMART Domains Protein: ENSMUSP00000125777
Gene: ENSMUSG00000000409

DomainStartEndE-ValueType
SH3 75 131 3.53e-17 SMART
SH2 136 226 2.07e-34 SMART
TyrKc 256 505 2.66e-133 SMART
Predicted Effect probably null
Transcript: ENSMUST00000167288
SMART Domains Protein: ENSMUSP00000125777
Gene: ENSMUSG00000000409

DomainStartEndE-ValueType
SH3 75 131 3.53e-17 SMART
SH2 136 226 2.07e-34 SMART
TyrKc 256 505 2.66e-133 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Src family of protein tyrosine kinases (PTKs). The encoded protein is a key signaling molecule in the selection and maturation of developing T-cells. It contains N-terminal sites for myristylation and palmitylation, a PTK domain, and SH2 and SH3 domains which are involved in mediating protein-protein interactions with phosphotyrosine-containing and proline-rich motifs, respectively. The protein localizes to the plasma membrane and pericentrosomal vesicles, and binds to cell surface receptors, including CD4 and CD8, and other signaling molecules. Multiple alternatively spliced variants encoding different isoforms have been described. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for mutations of this gene exhibit thymic atrophy with reduced numbers of peripheral T cells. Null mutants have few double positive and no mature single positive (SP) thymocytes. A hypomorph has decreased expression of CD3epsilon chain onSP thymocytes, whose numbers are reduced. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T A 3: 122,054,261 M77K probably benign Het
Amy1 A G 3: 113,556,120 V467A probably damaging Het
Atf4 T C 15: 80,256,330 V11A possibly damaging Het
B4galt1 T C 4: 40,807,268 N373D probably damaging Het
Bpifa3 A G 2: 154,135,578 K112R probably damaging Het
Chd2 T A 7: 73,491,357 Y596F possibly damaging Het
Clspn T C 4: 126,578,418 S962P probably damaging Het
Cyp2c68 T C 19: 39,734,318 D262G possibly damaging Het
Dcaf11 T C 14: 55,565,695 I282T probably damaging Het
Dmxl1 T C 18: 49,957,395 probably null Het
Dnah11 T G 12: 118,023,935 K2411Q probably damaging Het
Elf3 A G 1: 135,256,482 V196A probably benign Het
Fhad1 T G 4: 141,954,116 T538P probably damaging Het
Fkbp10 A G 11: 100,421,023 D174G probably damaging Het
Gas6 A G 8: 13,477,098 S217P probably damaging Het
Gm4778 T A 3: 94,266,652 H322Q possibly damaging Het
Heatr5b C T 17: 78,766,875 probably null Het
Iqgap3 A G 3: 88,115,908 E502G probably benign Het
Klc1 T C 12: 111,795,627 V577A possibly damaging Het
Mc3r C A 2: 172,249,690 Y277* probably null Het
Mlxipl T C 5: 135,133,604 V640A probably benign Het
Mrc2 A T 11: 105,332,343 N471Y probably damaging Het
Ncan T A 8: 70,102,017 H1050L probably damaging Het
Nrl C A 14: 55,522,432 V13F probably damaging Het
Obscn T A 11: 59,076,256 Y546F probably damaging Het
Olfr214 A G 6: 116,557,113 I229M probably damaging Het
Olfr654 T G 7: 104,587,890 S46A probably benign Het
Olfr799 A G 10: 129,648,091 probably null Het
Pde3b G A 7: 114,521,692 G684D probably damaging Het
Prkaa1 C T 15: 5,174,342 T244I probably benign Het
Scfd2 A T 5: 74,206,398 probably null Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Smg1 A T 7: 118,145,590 V3113D possibly damaging Het
Sorbs1 T C 19: 40,376,881 T153A probably benign Het
Spag16 A G 1: 69,870,289 T182A probably benign Het
Svs2 T C 2: 164,237,669 K106R possibly damaging Het
Tenm1 A G X: 43,074,695 V107A possibly damaging Het
Topaz1 A T 9: 122,799,485 I1546F possibly damaging Het
Tubgcp2 C A 7: 140,032,225 E78* probably null Het
Vars A G 17: 35,005,481 probably null Het
Vmn2r109 A T 17: 20,554,305 W263R probably benign Het
Other mutations in Lck
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01824:Lck APN 4 129558146 missense probably benign 0.00
IGL02666:Lck APN 4 129556419 missense probably damaging 0.98
iconoclast UTSW 4 129555604 missense probably damaging 1.00
lockdown UTSW 4 129558127 missense probably damaging 1.00
stromberg UTSW 4 129555640 missense probably damaging 1.00
studentenkarzer UTSW 4 129556305 missense probably damaging 1.00
swan UTSW 4 129555640 missense probably damaging 1.00
R0091:Lck UTSW 4 129555681 missense possibly damaging 0.88
R0480:Lck UTSW 4 129555640 missense probably damaging 1.00
R1013:Lck UTSW 4 129558127 missense probably damaging 1.00
R1510:Lck UTSW 4 129555668 missense possibly damaging 0.92
R1569:Lck UTSW 4 129555656 missense probably damaging 0.98
R1845:Lck UTSW 4 129558086 missense probably benign 0.00
R2001:Lck UTSW 4 129548937 missense probably benign 0.00
R2141:Lck UTSW 4 129548920 missense probably damaging 1.00
R4694:Lck UTSW 4 129548972 missense possibly damaging 0.66
R4737:Lck UTSW 4 129555984 missense possibly damaging 0.93
R5712:Lck UTSW 4 129556310 missense probably benign
R7023:Lck UTSW 4 129548865 missense possibly damaging 0.89
R7411:Lck UTSW 4 129551970 missense probably benign 0.02
R9044:Lck UTSW 4 129556305 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTTCAGAGTCTGAGCCTGG -3'
(R):5'- CCAACATCCTGGTGTCTGAC -3'

Sequencing Primer
(F):5'- AAGGTATGGCTTGGCTCCC -3'
(R):5'- CACGCTGAGCTGCAAGATTG -3'
Posted On 2017-01-03