Incidental Mutation 'R5706:Fhad1'
ID451968
Institutional Source Beutler Lab
Gene Symbol Fhad1
Ensembl Gene ENSMUSG00000051435
Gene Nameforkhead-associated (FHA) phosphopeptide binding domain 1
Synonyms
MMRRC Submission 043331-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R5706 (G1)
Quality Score124
Status Not validated
Chromosome4
Chromosomal Location141890438-142015082 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 141954116 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Proline at position 538 (T538P)
Ref Sequence ENSEMBL: ENSMUSP00000101406 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105779] [ENSMUST00000105780]
Predicted Effect probably damaging
Transcript: ENSMUST00000105779
AA Change: T538P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101405
Gene: ENSMUSG00000051435
AA Change: T538P

DomainStartEndE-ValueType
FHA 17 69 8.41e-8 SMART
low complexity region 111 124 N/A INTRINSIC
coiled coil region 307 434 N/A INTRINSIC
coiled coil region 640 915 N/A INTRINSIC
low complexity region 1091 1102 N/A INTRINSIC
coiled coil region 1111 1140 N/A INTRINSIC
coiled coil region 1255 1339 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105780
AA Change: T538P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101406
Gene: ENSMUSG00000051435
AA Change: T538P

DomainStartEndE-ValueType
FHA 17 69 8.41e-8 SMART
low complexity region 111 124 N/A INTRINSIC
coiled coil region 307 434 N/A INTRINSIC
coiled coil region 640 915 N/A INTRINSIC
low complexity region 1091 1102 N/A INTRINSIC
coiled coil region 1111 1140 N/A INTRINSIC
coiled coil region 1255 1339 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124125
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129192
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T A 3: 122,054,261 M77K probably benign Het
Amy1 A G 3: 113,556,120 V467A probably damaging Het
Atf4 T C 15: 80,256,330 V11A possibly damaging Het
B4galt1 T C 4: 40,807,268 N373D probably damaging Het
Bpifa3 A G 2: 154,135,578 K112R probably damaging Het
Chd2 T A 7: 73,491,357 Y596F possibly damaging Het
Clspn T C 4: 126,578,418 S962P probably damaging Het
Cyp2c68 T C 19: 39,734,318 D262G possibly damaging Het
Dcaf11 T C 14: 55,565,695 I282T probably damaging Het
Dmxl1 T C 18: 49,957,395 probably null Het
Dnah11 T G 12: 118,023,935 K2411Q probably damaging Het
Elf3 A G 1: 135,256,482 V196A probably benign Het
Fkbp10 A G 11: 100,421,023 D174G probably damaging Het
Gas6 A G 8: 13,477,098 S217P probably damaging Het
Gm4778 T A 3: 94,266,652 H322Q possibly damaging Het
Heatr5b C T 17: 78,766,875 probably null Het
Iqgap3 A G 3: 88,115,908 E502G probably benign Het
Klc1 T C 12: 111,795,627 V577A possibly damaging Het
Lck T C 4: 129,551,638 probably null Het
Mc3r C A 2: 172,249,690 Y277* probably null Het
Mlxipl T C 5: 135,133,604 V640A probably benign Het
Mrc2 A T 11: 105,332,343 N471Y probably damaging Het
Ncan T A 8: 70,102,017 H1050L probably damaging Het
Nrl C A 14: 55,522,432 V13F probably damaging Het
Obscn T A 11: 59,076,256 Y546F probably damaging Het
Olfr214 A G 6: 116,557,113 I229M probably damaging Het
Olfr654 T G 7: 104,587,890 S46A probably benign Het
Olfr799 A G 10: 129,648,091 probably null Het
Pde3b G A 7: 114,521,692 G684D probably damaging Het
Prkaa1 C T 15: 5,174,342 T244I probably benign Het
Scfd2 A T 5: 74,206,398 probably null Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Smg1 A T 7: 118,145,590 V3113D possibly damaging Het
Sorbs1 T C 19: 40,376,881 T153A probably benign Het
Spag16 A G 1: 69,870,289 T182A probably benign Het
Svs2 T C 2: 164,237,669 K106R possibly damaging Het
Tenm1 A G X: 43,074,695 V107A possibly damaging Het
Topaz1 A T 9: 122,799,485 I1546F possibly damaging Het
Tubgcp2 C A 7: 140,032,225 E78* probably null Het
Vars A G 17: 35,005,481 probably null Het
Vmn2r109 A T 17: 20,554,305 W263R probably benign Het
Other mutations in Fhad1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01065:Fhad1 APN 4 141905612 missense probably benign 0.02
IGL01478:Fhad1 APN 4 141951638 missense possibly damaging 0.84
IGL01752:Fhad1 APN 4 141972899 missense possibly damaging 0.82
IGL01788:Fhad1 APN 4 141932802 missense probably benign 0.00
IGL01919:Fhad1 APN 4 141964595 missense probably damaging 0.96
IGL02489:Fhad1 APN 4 141957620 missense probably damaging 0.97
IGL02568:Fhad1 APN 4 141932794 missense probably null 1.00
IGL02583:Fhad1 APN 4 142011644 utr 5 prime probably benign
IGL02716:Fhad1 APN 4 141918331 missense possibly damaging 0.89
IGL02819:Fhad1 APN 4 141918758 missense probably benign 0.23
IGL02820:Fhad1 APN 4 141918758 missense probably benign 0.23
IGL03038:Fhad1 APN 4 142002494 missense probably benign 0.38
IGL03167:Fhad1 APN 4 141972797 missense probably benign 0.00
IGL03255:Fhad1 APN 4 141972880 missense possibly damaging 0.79
BB002:Fhad1 UTSW 4 141954187 missense probably damaging 0.97
BB012:Fhad1 UTSW 4 141954187 missense probably damaging 0.97
PIT1430001:Fhad1 UTSW 4 141909749 missense probably damaging 0.99
R0014:Fhad1 UTSW 4 141928408 missense probably damaging 1.00
R0116:Fhad1 UTSW 4 141940095 missense probably benign 0.06
R0143:Fhad1 UTSW 4 141929646 splice site probably benign
R0178:Fhad1 UTSW 4 141955340 missense probably benign 0.31
R0308:Fhad1 UTSW 4 141985593 splice site probably benign
R0384:Fhad1 UTSW 4 142002426 missense probably benign
R0583:Fhad1 UTSW 4 141903990 missense probably benign 0.37
R1501:Fhad1 UTSW 4 141964625 missense probably benign
R1584:Fhad1 UTSW 4 141985511 missense probably benign 0.22
R1615:Fhad1 UTSW 4 141922323 missense probably damaging 0.99
R1991:Fhad1 UTSW 4 141982162 missense possibly damaging 0.75
R2060:Fhad1 UTSW 4 141899249 missense probably benign 0.08
R2079:Fhad1 UTSW 4 141991202 nonsense probably null
R2133:Fhad1 UTSW 4 141928400 missense probably damaging 1.00
R2337:Fhad1 UTSW 4 141922344 missense possibly damaging 0.84
R2843:Fhad1 UTSW 4 141904968 missense probably benign 0.06
R2844:Fhad1 UTSW 4 141904968 missense probably benign 0.06
R2845:Fhad1 UTSW 4 141904968 missense probably benign 0.06
R2846:Fhad1 UTSW 4 141904968 missense probably benign 0.06
R2866:Fhad1 UTSW 4 141920788 missense probably benign 0.00
R3119:Fhad1 UTSW 4 141918307 frame shift probably null
R3760:Fhad1 UTSW 4 141909813 missense probably damaging 1.00
R4180:Fhad1 UTSW 4 141985543 missense possibly damaging 0.69
R4466:Fhad1 UTSW 4 141957658 missense probably damaging 1.00
R4627:Fhad1 UTSW 4 141896468 missense possibly damaging 0.47
R4680:Fhad1 UTSW 4 142011547 nonsense probably null
R4725:Fhad1 UTSW 4 141928378 critical splice donor site probably null
R4755:Fhad1 UTSW 4 141928483 missense probably damaging 1.00
R4831:Fhad1 UTSW 4 141916067 splice site probably null
R4909:Fhad1 UTSW 4 141985511 missense probably benign 0.01
R4968:Fhad1 UTSW 4 141918307 missense probably damaging 1.00
R5004:Fhad1 UTSW 4 142002599 critical splice acceptor site probably null
R5036:Fhad1 UTSW 4 141920741 missense probably benign 0.03
R5048:Fhad1 UTSW 4 141964676 critical splice acceptor site probably null
R5416:Fhad1 UTSW 4 141918802 missense probably benign 0.39
R5504:Fhad1 UTSW 4 141985535 missense probably benign
R5586:Fhad1 UTSW 4 141905131 missense probably benign 0.44
R5692:Fhad1 UTSW 4 141963457 missense probably benign 0.00
R5773:Fhad1 UTSW 4 141929570 missense probably damaging 0.99
R5823:Fhad1 UTSW 4 141955306 missense possibly damaging 0.84
R5833:Fhad1 UTSW 4 142002527 missense probably damaging 1.00
R6170:Fhad1 UTSW 4 141890952 nonsense probably null
R6286:Fhad1 UTSW 4 141920898 missense probably damaging 1.00
R6610:Fhad1 UTSW 4 141916396 missense possibly damaging 0.94
R6755:Fhad1 UTSW 4 141964604 missense probably damaging 1.00
R7006:Fhad1 UTSW 4 141918291 frame shift probably null
R7008:Fhad1 UTSW 4 141918291 frame shift probably null
R7012:Fhad1 UTSW 4 141918291 frame shift probably null
R7014:Fhad1 UTSW 4 141918291 frame shift probably null
R7058:Fhad1 UTSW 4 141918291 frame shift probably null
R7059:Fhad1 UTSW 4 141918291 frame shift probably null
R7060:Fhad1 UTSW 4 141918291 frame shift probably null
R7159:Fhad1 UTSW 4 141951616 missense probably benign 0.01
R7472:Fhad1 UTSW 4 141964626 missense probably benign
R7670:Fhad1 UTSW 4 141951491 missense probably benign 0.01
R7694:Fhad1 UTSW 4 141905064 missense probably benign 0.41
R7745:Fhad1 UTSW 4 141890939 missense probably benign 0.00
R7848:Fhad1 UTSW 4 141905602 missense probably benign 0.29
R7853:Fhad1 UTSW 4 141909823 missense probably damaging 0.99
R7867:Fhad1 UTSW 4 141905591 missense probably benign 0.00
R7925:Fhad1 UTSW 4 141954187 missense probably damaging 0.97
R8089:Fhad1 UTSW 4 141957660 missense probably damaging 1.00
R8123:Fhad1 UTSW 4 141985525 missense probably benign 0.02
X0018:Fhad1 UTSW 4 141951616 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGGAGAGGGAAATTTCTTGCC -3'
(R):5'- TGACAGTATAGACCCCAGCTC -3'

Sequencing Primer
(F):5'- AAATTTCTTGCCCGGTTGCACAG -3'
(R):5'- TGGTGACAGAGCACATGTTCC -3'
Posted On2017-01-03