Mutagenetix > Incidental Mutation

Incidental Mutation 'R5706:Scfd2'

451969

Institutional Source

Beutler Lab

Gene Symbol

Scfd2

Ensembl Gene

ENSMUSG00000062110

Gene Name

Sec1 family domain containing 2

Synonyms

E430013M20Rik, STXBP1L1

MMRRC Submission

043331-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.096) question?

Stock #

R5706 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

74204816-74531759 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to T at 74206398 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000072857] [ENSMUST00000113542]

AlphaFold

Q8BTY8

Predicted Effect

probably null
Transcript: ENSMUST00000072857

SMART Domains

Protein: ENSMUSP00000072636
Gene: ENSMUSG00000062110

Domain	Start	End	E-Value	Type
Pfam:Sec1	25	668	1.4e-15	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000113542

SMART Domains

Protein: ENSMUSP00000109170
Gene: ENSMUSG00000062110

Domain	Start	End	E-Value	Type
low complexity region	471	479	N/A	INTRINSIC
low complexity region	506	516	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000121330

SMART Domains

Protein: ENSMUSP00000113668
Gene: ENSMUSG00000062110

Domain	Start	End	E-Value	Type
Pfam:Sec1	422	625	2.1e-8	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146015

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202465

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 95.1%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca4	T	A	3: 122,054,261	M77K	probably benign	Het
Amy1	A	G	3: 113,556,120	V467A	probably damaging	Het
Atf4	T	C	15: 80,256,330	V11A	possibly damaging	Het
B4galt1	T	C	4: 40,807,268	N373D	probably damaging	Het
Bpifa3	A	G	2: 154,135,578	K112R	probably damaging	Het
Chd2	T	A	7: 73,491,357	Y596F	possibly damaging	Het
Clspn	T	C	4: 126,578,418	S962P	probably damaging	Het
Cyp2c68	T	C	19: 39,734,318	D262G	possibly damaging	Het
Dcaf11	T	C	14: 55,565,695	I282T	probably damaging	Het
Dmxl1	T	C	18: 49,957,395		probably null	Het
Dnah11	T	G	12: 118,023,935	K2411Q	probably damaging	Het
Elf3	A	G	1: 135,256,482	V196A	probably benign	Het
Fhad1	T	G	4: 141,954,116	T538P	probably damaging	Het
Fkbp10	A	G	11: 100,421,023	D174G	probably damaging	Het
Gas6	A	G	8: 13,477,098	S217P	probably damaging	Het
Gm4778	T	A	3: 94,266,652	H322Q	possibly damaging	Het
Heatr5b	C	T	17: 78,766,875		probably null	Het
Iqgap3	A	G	3: 88,115,908	E502G	probably benign	Het
Klc1	T	C	12: 111,795,627	V577A	possibly damaging	Het
Lck	T	C	4: 129,551,638		probably null	Het
Mc3r	C	A	2: 172,249,690	Y277*	probably null	Het
Mlxipl	T	C	5: 135,133,604	V640A	probably benign	Het
Mrc2	A	T	11: 105,332,343	N471Y	probably damaging	Het
Ncan	T	A	8: 70,102,017	H1050L	probably damaging	Het
Nrl	C	A	14: 55,522,432	V13F	probably damaging	Het
Obscn	T	A	11: 59,076,256	Y546F	probably damaging	Het
Olfr214	A	G	6: 116,557,113	I229M	probably damaging	Het
Olfr654	T	G	7: 104,587,890	S46A	probably benign	Het
Olfr799	A	G	10: 129,648,091		probably null	Het
Pde3b	G	A	7: 114,521,692	G684D	probably damaging	Het
Prkaa1	C	T	15: 5,174,342	T244I	probably benign	Het
Slc22a30	G	A	19: 8,344,393	Q436*	probably null	Het
Smg1	A	T	7: 118,145,590	V3113D	possibly damaging	Het
Sorbs1	T	C	19: 40,376,881	T153A	probably benign	Het
Spag16	A	G	1: 69,870,289	T182A	probably benign	Het
Svs2	T	C	2: 164,237,669	K106R	possibly damaging	Het
Tenm1	A	G	X: 43,074,695	V107A	possibly damaging	Het
Topaz1	A	T	9: 122,799,485	I1546F	possibly damaging	Het
Tubgcp2	C	A	7: 140,032,225	E78*	probably null	Het
Vars	A	G	17: 35,005,481		probably null	Het
Vmn2r109	A	T	17: 20,554,305	W263R	probably benign	Het

Other mutations in Scfd2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00970:Scfd2	APN	5	74530934	missense	possibly damaging	0.67
IGL01094:Scfd2	APN	5	74531046	missense	possibly damaging	0.69
IGL02928:Scfd2	APN	5	74531171	missense	probably damaging	1.00
IGL03365:Scfd2	APN	5	74530935	missense	possibly damaging	0.67
BB009:Scfd2	UTSW	5	74531550	missense	probably benign	0.33
BB019:Scfd2	UTSW	5	74531550	missense	probably benign	0.33
P0035:Scfd2	UTSW	5	74225319	missense	possibly damaging	0.89
R1696:Scfd2	UTSW	5	74530878	missense	probably benign
R1857:Scfd2	UTSW	5	74212301	nonsense	probably null
R2136:Scfd2	UTSW	5	74206367	missense	probably benign	0.01
R2205:Scfd2	UTSW	5	74225367	missense	possibly damaging	0.93
R2504:Scfd2	UTSW	5	74531177	missense	probably damaging	1.00
R3864:Scfd2	UTSW	5	74397720	missense	possibly damaging	0.49
R4439:Scfd2	UTSW	5	74397707	missense	possibly damaging	0.69
R4590:Scfd2	UTSW	5	74212256	missense	probably benign	0.01
R4703:Scfd2	UTSW	5	74519595	missense	probably benign	0.00
R4901:Scfd2	UTSW	5	74519565	missense	probably damaging	1.00
R4916:Scfd2	UTSW	5	74462658	missense	probably damaging	1.00
R4970:Scfd2	UTSW	5	74206321	missense	probably benign	0.15
R5112:Scfd2	UTSW	5	74206321	missense	probably benign	0.15
R5474:Scfd2	UTSW	5	74531364	missense	probably benign	0.24
R5766:Scfd2	UTSW	5	74462651	missense	probably damaging	1.00
R6769:Scfd2	UTSW	5	74531456	missense	probably benign	0.01
R6771:Scfd2	UTSW	5	74531456	missense	probably benign	0.01
R6961:Scfd2	UTSW	5	74519541	missense	possibly damaging	0.86
R6963:Scfd2	UTSW	5	74482209	missense	probably damaging	1.00
R7151:Scfd2	UTSW	5	74397665	missense	possibly damaging	0.56
R7159:Scfd2	UTSW	5	74531343	missense	probably benign	0.01
R7510:Scfd2	UTSW	5	74212327	missense	probably damaging	1.00
R7602:Scfd2	UTSW	5	74462610	missense	probably benign	0.32
R7678:Scfd2	UTSW	5	74458636	missense	probably benign
R7932:Scfd2	UTSW	5	74531550	missense	probably benign	0.33
R8074:Scfd2	UTSW	5	74519596	missense	probably benign	0.00
R8088:Scfd2	UTSW	5	74531363	missense	probably benign	0.12
R8511:Scfd2	UTSW	5	74212288	missense	possibly damaging	0.84
R8725:Scfd2	UTSW	5	74482239	missense	probably benign	0.01
R8837:Scfd2	UTSW	5	74530995	missense	probably benign	0.19
R9015:Scfd2	UTSW	5	74530964	missense	probably damaging	1.00
R9055:Scfd2	UTSW	5	74531270	missense	possibly damaging	0.50
R9336:Scfd2	UTSW	5	74531345	missense	probably damaging	1.00
R9489:Scfd2	UTSW	5	74519574	missense	probably damaging	1.00
R9691:Scfd2	UTSW	5	74530950	missense	possibly damaging	0.82
R9719:Scfd2	UTSW	5	74225343	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGTTGAAGACCCAGTCCAGTCC -3'
(R):5'- TTGGACCCAAAGGCTCATGG -3'

Sequencing Primer
(F):5'- CCTCTCTGGTAGAATTAAGTCATACC -3'
(R):5'- GCTCATGGGCTAGGTGATC -3'

Posted On

2017-01-03