Incidental Mutation 'R5706:Scfd2'
ID451969
Institutional Source Beutler Lab
Gene Symbol Scfd2
Ensembl Gene ENSMUSG00000062110
Gene NameSec1 family domain containing 2
SynonymsE430013M20Rik, STXBP1L1
MMRRC Submission 043331-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R5706 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location74204816-74531759 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 74206398 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000072857] [ENSMUST00000113542]
Predicted Effect probably null
Transcript: ENSMUST00000072857
SMART Domains Protein: ENSMUSP00000072636
Gene: ENSMUSG00000062110

DomainStartEndE-ValueType
Pfam:Sec1 25 668 1.4e-15 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000113542
SMART Domains Protein: ENSMUSP00000109170
Gene: ENSMUSG00000062110

DomainStartEndE-ValueType
low complexity region 471 479 N/A INTRINSIC
low complexity region 506 516 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000121330
SMART Domains Protein: ENSMUSP00000113668
Gene: ENSMUSG00000062110

DomainStartEndE-ValueType
Pfam:Sec1 422 625 2.1e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146015
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202465
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T A 3: 122,054,261 M77K probably benign Het
Amy1 A G 3: 113,556,120 V467A probably damaging Het
Atf4 T C 15: 80,256,330 V11A possibly damaging Het
B4galt1 T C 4: 40,807,268 N373D probably damaging Het
Bpifa3 A G 2: 154,135,578 K112R probably damaging Het
Chd2 T A 7: 73,491,357 Y596F possibly damaging Het
Clspn T C 4: 126,578,418 S962P probably damaging Het
Cyp2c68 T C 19: 39,734,318 D262G possibly damaging Het
Dcaf11 T C 14: 55,565,695 I282T probably damaging Het
Dmxl1 T C 18: 49,957,395 probably null Het
Dnah11 T G 12: 118,023,935 K2411Q probably damaging Het
Elf3 A G 1: 135,256,482 V196A probably benign Het
Fhad1 T G 4: 141,954,116 T538P probably damaging Het
Fkbp10 A G 11: 100,421,023 D174G probably damaging Het
Gas6 A G 8: 13,477,098 S217P probably damaging Het
Gm4778 T A 3: 94,266,652 H322Q possibly damaging Het
Heatr5b C T 17: 78,766,875 probably null Het
Iqgap3 A G 3: 88,115,908 E502G probably benign Het
Klc1 T C 12: 111,795,627 V577A possibly damaging Het
Lck T C 4: 129,551,638 probably null Het
Mc3r C A 2: 172,249,690 Y277* probably null Het
Mlxipl T C 5: 135,133,604 V640A probably benign Het
Mrc2 A T 11: 105,332,343 N471Y probably damaging Het
Ncan T A 8: 70,102,017 H1050L probably damaging Het
Nrl C A 14: 55,522,432 V13F probably damaging Het
Obscn T A 11: 59,076,256 Y546F probably damaging Het
Olfr214 A G 6: 116,557,113 I229M probably damaging Het
Olfr654 T G 7: 104,587,890 S46A probably benign Het
Olfr799 A G 10: 129,648,091 probably null Het
Pde3b G A 7: 114,521,692 G684D probably damaging Het
Prkaa1 C T 15: 5,174,342 T244I probably benign Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Smg1 A T 7: 118,145,590 V3113D possibly damaging Het
Sorbs1 T C 19: 40,376,881 T153A probably benign Het
Spag16 A G 1: 69,870,289 T182A probably benign Het
Svs2 T C 2: 164,237,669 K106R possibly damaging Het
Tenm1 A G X: 43,074,695 V107A possibly damaging Het
Topaz1 A T 9: 122,799,485 I1546F possibly damaging Het
Tubgcp2 C A 7: 140,032,225 E78* probably null Het
Vars A G 17: 35,005,481 probably null Het
Vmn2r109 A T 17: 20,554,305 W263R probably benign Het
Other mutations in Scfd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00970:Scfd2 APN 5 74530934 missense possibly damaging 0.67
IGL01094:Scfd2 APN 5 74531046 missense possibly damaging 0.69
IGL02928:Scfd2 APN 5 74531171 missense probably damaging 1.00
IGL03365:Scfd2 APN 5 74530935 missense possibly damaging 0.67
BB009:Scfd2 UTSW 5 74531550 missense probably benign 0.33
BB019:Scfd2 UTSW 5 74531550 missense probably benign 0.33
P0035:Scfd2 UTSW 5 74225319 missense possibly damaging 0.89
R1696:Scfd2 UTSW 5 74530878 missense probably benign
R1857:Scfd2 UTSW 5 74212301 nonsense probably null
R2136:Scfd2 UTSW 5 74206367 missense probably benign 0.01
R2205:Scfd2 UTSW 5 74225367 missense possibly damaging 0.93
R2504:Scfd2 UTSW 5 74531177 missense probably damaging 1.00
R3864:Scfd2 UTSW 5 74397720 missense possibly damaging 0.49
R4439:Scfd2 UTSW 5 74397707 missense possibly damaging 0.69
R4590:Scfd2 UTSW 5 74212256 missense probably benign 0.01
R4703:Scfd2 UTSW 5 74519595 missense probably benign 0.00
R4901:Scfd2 UTSW 5 74519565 missense probably damaging 1.00
R4916:Scfd2 UTSW 5 74462658 missense probably damaging 1.00
R4970:Scfd2 UTSW 5 74206321 missense probably benign 0.15
R5112:Scfd2 UTSW 5 74206321 missense probably benign 0.15
R5474:Scfd2 UTSW 5 74531364 missense probably benign 0.24
R5766:Scfd2 UTSW 5 74462651 missense probably damaging 1.00
R6769:Scfd2 UTSW 5 74531456 missense probably benign 0.01
R6771:Scfd2 UTSW 5 74531456 missense probably benign 0.01
R6961:Scfd2 UTSW 5 74519541 missense possibly damaging 0.86
R6963:Scfd2 UTSW 5 74482209 missense probably damaging 1.00
R7151:Scfd2 UTSW 5 74397665 missense possibly damaging 0.56
R7159:Scfd2 UTSW 5 74531343 missense probably benign 0.01
R7510:Scfd2 UTSW 5 74212327 missense probably damaging 1.00
R7602:Scfd2 UTSW 5 74462610 missense probably benign 0.32
R7678:Scfd2 UTSW 5 74458636 missense probably benign
R7932:Scfd2 UTSW 5 74531550 missense probably benign 0.33
R8074:Scfd2 UTSW 5 74519596 missense probably benign 0.00
R8088:Scfd2 UTSW 5 74531363 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- TGTTGAAGACCCAGTCCAGTCC -3'
(R):5'- TTGGACCCAAAGGCTCATGG -3'

Sequencing Primer
(F):5'- CCTCTCTGGTAGAATTAAGTCATACC -3'
(R):5'- GCTCATGGGCTAGGTGATC -3'
Posted On2017-01-03