Incidental Mutation 'R5706:Scfd2'
ID 451969
Institutional Source Beutler Lab
Gene Symbol Scfd2
Ensembl Gene ENSMUSG00000062110
Gene Name Sec1 family domain containing 2
Synonyms E430013M20Rik, STXBP1L1
MMRRC Submission 043331-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.074) question?
Stock # R5706 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 74365477-74692420 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) A to T at 74367059 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000072857] [ENSMUST00000113542]
AlphaFold Q8BTY8
Predicted Effect probably null
Transcript: ENSMUST00000072857
SMART Domains Protein: ENSMUSP00000072636
Gene: ENSMUSG00000062110

DomainStartEndE-ValueType
Pfam:Sec1 25 668 1.4e-15 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000113542
SMART Domains Protein: ENSMUSP00000109170
Gene: ENSMUSG00000062110

DomainStartEndE-ValueType
low complexity region 471 479 N/A INTRINSIC
low complexity region 506 516 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000121330
SMART Domains Protein: ENSMUSP00000113668
Gene: ENSMUSG00000062110

DomainStartEndE-ValueType
Pfam:Sec1 422 625 2.1e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146015
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202465
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T A 3: 121,847,910 (GRCm39) M77K probably benign Het
Amy1 A G 3: 113,349,769 (GRCm39) V467A probably damaging Het
Atf4 T C 15: 80,140,531 (GRCm39) V11A possibly damaging Het
B4galt1 T C 4: 40,807,268 (GRCm39) N373D probably damaging Het
Bpifa3 A G 2: 153,977,498 (GRCm39) K112R probably damaging Het
Chd2 T A 7: 73,141,105 (GRCm39) Y596F possibly damaging Het
Clspn T C 4: 126,472,211 (GRCm39) S962P probably damaging Het
Cyp2c68 T C 19: 39,722,762 (GRCm39) D262G possibly damaging Het
Dcaf11 T C 14: 55,803,152 (GRCm39) I282T probably damaging Het
Dmxl1 T C 18: 50,090,462 (GRCm39) probably null Het
Dnah11 T G 12: 117,987,670 (GRCm39) K2411Q probably damaging Het
Elf3 A G 1: 135,184,220 (GRCm39) V196A probably benign Het
Fhad1 T G 4: 141,681,427 (GRCm39) T538P probably damaging Het
Fkbp10 A G 11: 100,311,849 (GRCm39) D174G probably damaging Het
Gas6 A G 8: 13,527,098 (GRCm39) S217P probably damaging Het
Heatr5b C T 17: 79,074,304 (GRCm39) probably null Het
Iqgap3 A G 3: 88,023,215 (GRCm39) E502G probably benign Het
Klc1 T C 12: 111,762,061 (GRCm39) V577A possibly damaging Het
Lck T C 4: 129,445,431 (GRCm39) probably null Het
Mc3r C A 2: 172,091,610 (GRCm39) Y277* probably null Het
Mlxipl T C 5: 135,162,458 (GRCm39) V640A probably benign Het
Mrc2 A T 11: 105,223,169 (GRCm39) N471Y probably damaging Het
Ncan T A 8: 70,554,667 (GRCm39) H1050L probably damaging Het
Nrl C A 14: 55,759,889 (GRCm39) V13F probably damaging Het
Obscn T A 11: 58,967,082 (GRCm39) Y546F probably damaging Het
Or52u1 T G 7: 104,237,097 (GRCm39) S46A probably benign Het
Or6c209 A G 10: 129,483,960 (GRCm39) probably null Het
Or6d14 A G 6: 116,534,074 (GRCm39) I229M probably damaging Het
Pde3b G A 7: 114,120,927 (GRCm39) G684D probably damaging Het
Prkaa1 C T 15: 5,203,823 (GRCm39) T244I probably benign Het
Slc22a30 G A 19: 8,321,757 (GRCm39) Q436* probably null Het
Smg1 A T 7: 117,744,813 (GRCm39) V3113D possibly damaging Het
Sorbs1 T C 19: 40,365,325 (GRCm39) T153A probably benign Het
Spag16 A G 1: 69,909,448 (GRCm39) T182A probably benign Het
Spopfm1 T A 3: 94,173,959 (GRCm39) H322Q possibly damaging Het
Svs5 T C 2: 164,079,589 (GRCm39) K106R possibly damaging Het
Tenm1 A G X: 42,163,572 (GRCm39) V107A possibly damaging Het
Topaz1 A T 9: 122,628,550 (GRCm39) I1546F possibly damaging Het
Tubgcp2 C A 7: 139,612,138 (GRCm39) E78* probably null Het
Vars1 A G 17: 35,224,457 (GRCm39) probably null Het
Vmn2r109 A T 17: 20,774,567 (GRCm39) W263R probably benign Het
Other mutations in Scfd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00970:Scfd2 APN 5 74,691,595 (GRCm39) missense possibly damaging 0.67
IGL01094:Scfd2 APN 5 74,691,707 (GRCm39) missense possibly damaging 0.69
IGL02928:Scfd2 APN 5 74,691,832 (GRCm39) missense probably damaging 1.00
IGL03365:Scfd2 APN 5 74,691,596 (GRCm39) missense possibly damaging 0.67
BB009:Scfd2 UTSW 5 74,692,211 (GRCm39) missense probably benign 0.33
BB019:Scfd2 UTSW 5 74,692,211 (GRCm39) missense probably benign 0.33
P0035:Scfd2 UTSW 5 74,385,980 (GRCm39) missense possibly damaging 0.89
R1696:Scfd2 UTSW 5 74,691,539 (GRCm39) missense probably benign
R1857:Scfd2 UTSW 5 74,372,962 (GRCm39) nonsense probably null
R2136:Scfd2 UTSW 5 74,367,028 (GRCm39) missense probably benign 0.01
R2205:Scfd2 UTSW 5 74,386,028 (GRCm39) missense possibly damaging 0.93
R2504:Scfd2 UTSW 5 74,691,838 (GRCm39) missense probably damaging 1.00
R3864:Scfd2 UTSW 5 74,558,381 (GRCm39) missense possibly damaging 0.49
R4439:Scfd2 UTSW 5 74,558,368 (GRCm39) missense possibly damaging 0.69
R4590:Scfd2 UTSW 5 74,372,917 (GRCm39) missense probably benign 0.01
R4703:Scfd2 UTSW 5 74,680,256 (GRCm39) missense probably benign 0.00
R4901:Scfd2 UTSW 5 74,680,226 (GRCm39) missense probably damaging 1.00
R4916:Scfd2 UTSW 5 74,623,319 (GRCm39) missense probably damaging 1.00
R4970:Scfd2 UTSW 5 74,366,982 (GRCm39) missense probably benign 0.15
R5112:Scfd2 UTSW 5 74,366,982 (GRCm39) missense probably benign 0.15
R5474:Scfd2 UTSW 5 74,692,025 (GRCm39) missense probably benign 0.24
R5766:Scfd2 UTSW 5 74,623,312 (GRCm39) missense probably damaging 1.00
R6769:Scfd2 UTSW 5 74,692,117 (GRCm39) missense probably benign 0.01
R6771:Scfd2 UTSW 5 74,692,117 (GRCm39) missense probably benign 0.01
R6961:Scfd2 UTSW 5 74,680,202 (GRCm39) missense possibly damaging 0.86
R6963:Scfd2 UTSW 5 74,642,870 (GRCm39) missense probably damaging 1.00
R7151:Scfd2 UTSW 5 74,558,326 (GRCm39) missense possibly damaging 0.56
R7159:Scfd2 UTSW 5 74,692,004 (GRCm39) missense probably benign 0.01
R7510:Scfd2 UTSW 5 74,372,988 (GRCm39) missense probably damaging 1.00
R7602:Scfd2 UTSW 5 74,623,271 (GRCm39) missense probably benign 0.32
R7678:Scfd2 UTSW 5 74,619,297 (GRCm39) missense probably benign
R7932:Scfd2 UTSW 5 74,692,211 (GRCm39) missense probably benign 0.33
R8074:Scfd2 UTSW 5 74,680,257 (GRCm39) missense probably benign 0.00
R8088:Scfd2 UTSW 5 74,692,024 (GRCm39) missense probably benign 0.12
R8511:Scfd2 UTSW 5 74,372,949 (GRCm39) missense possibly damaging 0.84
R8725:Scfd2 UTSW 5 74,642,900 (GRCm39) missense probably benign 0.01
R8837:Scfd2 UTSW 5 74,691,656 (GRCm39) missense probably benign 0.19
R9015:Scfd2 UTSW 5 74,691,625 (GRCm39) missense probably damaging 1.00
R9055:Scfd2 UTSW 5 74,691,931 (GRCm39) missense possibly damaging 0.50
R9336:Scfd2 UTSW 5 74,692,006 (GRCm39) missense probably damaging 1.00
R9489:Scfd2 UTSW 5 74,680,235 (GRCm39) missense probably damaging 1.00
R9691:Scfd2 UTSW 5 74,691,611 (GRCm39) missense possibly damaging 0.82
R9719:Scfd2 UTSW 5 74,386,004 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTTGAAGACCCAGTCCAGTCC -3'
(R):5'- TTGGACCCAAAGGCTCATGG -3'

Sequencing Primer
(F):5'- CCTCTCTGGTAGAATTAAGTCATACC -3'
(R):5'- GCTCATGGGCTAGGTGATC -3'
Posted On 2017-01-03