Mutagenetix > Incidental Mutations

Incidental Mutation 'R5706:Mlxipl'

451970

Institutional Source

Beutler Lab

Gene Symbol

Mlxipl

Ensembl Gene

ENSMUSG00000005373

Gene Name

MLX interacting protein-like

Synonyms

WS-bHLH, Wbscr14, bHLHd14, ChREBP

MMRRC Submission

043331-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.484) question?

Stock #

R5706 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

135089890-135138382 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 135133604 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 640 (V640A)

Ref Sequence

ENSEMBL: ENSMUSP00000122198 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005507] [ENSMUST00000128691] [ENSMUST00000129008] [ENSMUST00000142385] [ENSMUST00000153519]

PDB Structure

Complex of ChREBP and 14-3-3beta [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000005507
AA Change: V640A

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000005507
Gene: ENSMUSG00000005373
AA Change: V640A

Domain	Start	End	E-Value	Type
low complexity region	19	34	N/A	INTRINSIC
PDB:4GNT\|B	117	137	1e-8	PDB
low complexity region	261	271	N/A	INTRINSIC
low complexity region	341	350	N/A	INTRINSIC
low complexity region	387	408	N/A	INTRINSIC
low complexity region	414	437	N/A	INTRINSIC
low complexity region	457	473	N/A	INTRINSIC
low complexity region	513	531	N/A	INTRINSIC
low complexity region	574	603	N/A	INTRINSIC
HLH	667	721	1.14e-9	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000123370

SMART Domains

Protein: ENSMUSP00000116358
Gene: ENSMUSG00000005373

Domain	Start	End	E-Value	Type
HLH	19	73	1.14e-9	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000128691
AA Change: V640A

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000121348
Gene: ENSMUSG00000005373
AA Change: V640A

Domain	Start	End	E-Value	Type
low complexity region	19	34	N/A	INTRINSIC
PDB:4GNT\|B	117	137	9e-9	PDB
low complexity region	261	271	N/A	INTRINSIC
low complexity region	341	350	N/A	INTRINSIC
low complexity region	387	408	N/A	INTRINSIC
low complexity region	414	437	N/A	INTRINSIC
low complexity region	457	473	N/A	INTRINSIC
low complexity region	513	531	N/A	INTRINSIC
low complexity region	574	603	N/A	INTRINSIC
SCOP:d1hloa_	658	709	6e-7	SMART
Blast:HLH	667	699	1e-12	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000129008

SMART Domains

Protein: ENSMUSP00000114933
Gene: ENSMUSG00000005373

Domain	Start	End	E-Value	Type
low complexity region	19	34	N/A	INTRINSIC
PDB:4GNT\|B	117	137	7e-9	PDB
low complexity region	261	271	N/A	INTRINSIC
low complexity region	341	350	N/A	INTRINSIC
low complexity region	387	408	N/A	INTRINSIC
low complexity region	414	437	N/A	INTRINSIC
low complexity region	457	473	N/A	INTRINSIC
low complexity region	513	531	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000142385

SMART Domains

Protein: ENSMUSP00000144328
Gene: ENSMUSG00000005373

Domain	Start	End	E-Value	Type
low complexity region	19	34	N/A	INTRINSIC
PDB:4GNT\|B	117	137	7e-9	PDB
low complexity region	261	271	N/A	INTRINSIC
low complexity region	341	350	N/A	INTRINSIC
low complexity region	387	408	N/A	INTRINSIC
low complexity region	414	437	N/A	INTRINSIC
low complexity region	457	473	N/A	INTRINSIC
low complexity region	513	531	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000153519
AA Change: V640A

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000122198
Gene: ENSMUSG00000005373
AA Change: V640A

Domain	Start	End	E-Value	Type
low complexity region	19	34	N/A	INTRINSIC
PDB:4GNT\|B	117	137	9e-9	PDB
low complexity region	261	271	N/A	INTRINSIC
low complexity region	341	350	N/A	INTRINSIC
low complexity region	387	408	N/A	INTRINSIC
low complexity region	414	437	N/A	INTRINSIC
low complexity region	457	473	N/A	INTRINSIC
low complexity region	513	531	N/A	INTRINSIC
low complexity region	574	603	N/A	INTRINSIC
SCOP:d1am9a_	658	696	1e-5	SMART
Blast:HLH	667	698	2e-12	BLAST
low complexity region	728	744	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000154840

SMART Domains

Protein: ENSMUSP00000121668
Gene: ENSMUSG00000005373

Domain	Start	End	E-Value	Type
HLH	26	120	7.9e-4	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a basic helix-loop-helix leucine zipper transcription factor of the Myc/Max/Mad superfamily. This protein forms a heterodimeric complex and binds and activates, in a glucose-dependent manner, carbohydrate response element (ChoRE) motifs in the promoters of triglyceride synthesis genes. The gene is deleted in Williams-Beuren syndrome, a multisystem developmental disorder caused by the deletion of contiguous genes at chromosome 7q11.23. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced glycolysis and lipogenesis and severe simple carbohydrate intolerance. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca4	T	A	3: 122,054,261	M77K	probably benign	Het
Amy1	A	G	3: 113,556,120	V467A	probably damaging	Het
Atf4	T	C	15: 80,256,330	V11A	possibly damaging	Het
B4galt1	T	C	4: 40,807,268	N373D	probably damaging	Het
Bpifa3	A	G	2: 154,135,578	K112R	probably damaging	Het
Chd2	T	A	7: 73,491,357	Y596F	possibly damaging	Het
Clspn	T	C	4: 126,578,418	S962P	probably damaging	Het
Cyp2c68	T	C	19: 39,734,318	D262G	possibly damaging	Het
Dcaf11	T	C	14: 55,565,695	I282T	probably damaging	Het
Dmxl1	T	C	18: 49,957,395		probably null	Het
Dnah11	T	G	12: 118,023,935	K2411Q	probably damaging	Het
Elf3	A	G	1: 135,256,482	V196A	probably benign	Het
Fhad1	T	G	4: 141,954,116	T538P	probably damaging	Het
Fkbp10	A	G	11: 100,421,023	D174G	probably damaging	Het
Gas6	A	G	8: 13,477,098	S217P	probably damaging	Het
Gm4778	T	A	3: 94,266,652	H322Q	possibly damaging	Het
Heatr5b	C	T	17: 78,766,875		probably null	Het
Iqgap3	A	G	3: 88,115,908	E502G	probably benign	Het
Klc1	T	C	12: 111,795,627	V577A	possibly damaging	Het
Lck	T	C	4: 129,551,638		probably null	Het
Mc3r	C	A	2: 172,249,690	Y277*	probably null	Het
Mrc2	A	T	11: 105,332,343	N471Y	probably damaging	Het
Ncan	T	A	8: 70,102,017	H1050L	probably damaging	Het
Nrl	C	A	14: 55,522,432	V13F	probably damaging	Het
Obscn	T	A	11: 59,076,256	Y546F	probably damaging	Het
Olfr214	A	G	6: 116,557,113	I229M	probably damaging	Het
Olfr654	T	G	7: 104,587,890	S46A	probably benign	Het
Olfr799	A	G	10: 129,648,091		probably null	Het
Pde3b	G	A	7: 114,521,692	G684D	probably damaging	Het
Prkaa1	C	T	15: 5,174,342	T244I	probably benign	Het
Scfd2	A	T	5: 74,206,398		probably null	Het
Slc22a30	G	A	19: 8,344,393	Q436*	probably null	Het
Smg1	A	T	7: 118,145,590	V3113D	possibly damaging	Het
Sorbs1	T	C	19: 40,376,881	T153A	probably benign	Het
Spag16	A	G	1: 69,870,289	T182A	probably benign	Het
Svs2	T	C	2: 164,237,669	K106R	possibly damaging	Het
Tenm1	A	G	X: 43,074,695	V107A	possibly damaging	Het
Topaz1	A	T	9: 122,799,485	I1546F	possibly damaging	Het
Tubgcp2	C	A	7: 140,032,225	E78*	probably null	Het
Vars	A	G	17: 35,005,481		probably null	Het
Vmn2r109	A	T	17: 20,554,305	W263R	probably benign	Het

Other mutations in Mlxipl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00771:Mlxipl	APN	5	135132778	missense	probably damaging	0.98
IGL01872:Mlxipl	APN	5	135113691	missense	probably damaging	1.00
IGL02694:Mlxipl	APN	5	135124018	critical splice donor site	probably null
IGL03070:Mlxipl	APN	5	135132453	missense	possibly damaging	0.93
Scarlet	UTSW	5	135134030	missense	possibly damaging	0.93
H8441:Mlxipl	UTSW	5	135123961	missense	probably damaging	1.00
IGL03054:Mlxipl	UTSW	5	135133256	missense	possibly damaging	0.83
R0003:Mlxipl	UTSW	5	135133189	unclassified	probably benign
R0126:Mlxipl	UTSW	5	135132323	missense	probably damaging	0.96
R0458:Mlxipl	UTSW	5	135133370	missense	probably benign	0.33
R0513:Mlxipl	UTSW	5	135137263	missense	probably benign	0.33
R0580:Mlxipl	UTSW	5	135123975	missense	probably benign	0.01
R0744:Mlxipl	UTSW	5	135132475	missense	possibly damaging	0.86
R0827:Mlxipl	UTSW	5	135132738	missense	probably benign	0.00
R1052:Mlxipl	UTSW	5	135113710	missense	probably damaging	1.00
R1241:Mlxipl	UTSW	5	135132718	missense	probably benign	0.01
R1795:Mlxipl	UTSW	5	135107170	missense	probably damaging	1.00
R1903:Mlxipl	UTSW	5	135133568	missense	possibly damaging	0.92
R2038:Mlxipl	UTSW	5	135106999	missense	probably damaging	1.00
R2064:Mlxipl	UTSW	5	135132777	missense	possibly damaging	0.77
R2069:Mlxipl	UTSW	5	135107005	missense	probably damaging	1.00
R2081:Mlxipl	UTSW	5	135113638	missense	probably damaging	1.00
R2095:Mlxipl	UTSW	5	135122120	splice site	probably benign
R3114:Mlxipl	UTSW	5	135133662	splice site	probably benign
R4018:Mlxipl	UTSW	5	135132672	missense	probably damaging	1.00
R4090:Mlxipl	UTSW	5	135132527	missense	probably benign	0.33
R4321:Mlxipl	UTSW	5	135135450	nonsense	probably null
R4414:Mlxipl	UTSW	5	135137399	unclassified	probably benign
R6088:Mlxipl	UTSW	5	135134030	missense	possibly damaging	0.93
R6508:Mlxipl	UTSW	5	135128620	missense	probably benign	0.03
R6704:Mlxipl	UTSW	5	135137240	critical splice acceptor site	probably null
R7060:Mlxipl	UTSW	5	135132315	missense	possibly damaging	0.88
R7095:Mlxipl	UTSW	5	135134030	missense	possibly damaging	0.93
R7128:Mlxipl	UTSW	5	135133851	missense	probably damaging	0.98
R7464:Mlxipl	UTSW	5	135133628	missense	probably benign	0.01
R7510:Mlxipl	UTSW	5	135133118	missense	possibly damaging	0.72
R7669:Mlxipl	UTSW	5	135132370	missense	possibly damaging	0.53
R7737:Mlxipl	UTSW	5	135135381	missense	possibly damaging	0.73
R7806:Mlxipl	UTSW	5	135134543	missense	possibly damaging	0.93
R7910:Mlxipl	UTSW	5	135132409	missense	possibly damaging	0.85
R8118:Mlxipl	UTSW	5	135137248	missense	possibly damaging	0.96
R8363:Mlxipl	UTSW	5	135107076	missense	probably benign	0.18

Predicted Primers

PCR Primer
(F):5'- TGGTTGTCCCCAAAGCAGAG -3'
(R):5'- GTGTGATACGTCGGTTCTCCATC -3'

Sequencing Primer
(F):5'- GCCTCCAGCGGTAAATAGG -3'
(R):5'- GTCGGTTCTCCATCTTAGAAAGCAG -3'

Posted On

2017-01-03