Incidental Mutation 'R5706:Olfr214'
ID 451971
Institutional Source Beutler Lab
Gene Symbol Olfr214
Ensembl Gene ENSMUSG00000051046
Gene Name olfactory receptor 214
Synonyms MOR119-1, GA_x54KRFPKN04-58190962-58191900
MMRRC Submission 043331-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.375) question?
Stock # R5706 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 116554235-116560611 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 116557113 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Methionine at position 229 (I229M)
Ref Sequence ENSEMBL: ENSMUSP00000150737 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060204] [ENSMUST00000122096] [ENSMUST00000203867] [ENSMUST00000214699] [ENSMUST00000215846] [ENSMUST00000217313]
AlphaFold Q8VG27
Predicted Effect probably damaging
Transcript: ENSMUST00000060204
AA Change: I229M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052730
Gene: ENSMUSG00000051046
AA Change: I229M

DomainStartEndE-ValueType
Pfam:7tm_4 39 316 4.7e-47 PFAM
Pfam:7tm_1 49 298 5.9e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122096
SMART Domains Protein: ENSMUSP00000145194
Gene: ENSMUSG00000107906

DomainStartEndE-ValueType
DEXDc 57 254 2.4e-59 SMART
HELICc 291 372 6.6e-38 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000203867
AA Change: I229M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000145465
Gene: ENSMUSG00000051046
AA Change: I229M

DomainStartEndE-ValueType
Pfam:7tm_4 39 316 4.7e-47 PFAM
Pfam:7tm_1 49 298 5.9e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214699
AA Change: I229M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000215846
AA Change: I229M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000217313
AA Change: I229M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T A 3: 122,054,261 M77K probably benign Het
Amy1 A G 3: 113,556,120 V467A probably damaging Het
Atf4 T C 15: 80,256,330 V11A possibly damaging Het
B4galt1 T C 4: 40,807,268 N373D probably damaging Het
Bpifa3 A G 2: 154,135,578 K112R probably damaging Het
Chd2 T A 7: 73,491,357 Y596F possibly damaging Het
Clspn T C 4: 126,578,418 S962P probably damaging Het
Cyp2c68 T C 19: 39,734,318 D262G possibly damaging Het
Dcaf11 T C 14: 55,565,695 I282T probably damaging Het
Dmxl1 T C 18: 49,957,395 probably null Het
Dnah11 T G 12: 118,023,935 K2411Q probably damaging Het
Elf3 A G 1: 135,256,482 V196A probably benign Het
Fhad1 T G 4: 141,954,116 T538P probably damaging Het
Fkbp10 A G 11: 100,421,023 D174G probably damaging Het
Gas6 A G 8: 13,477,098 S217P probably damaging Het
Gm4778 T A 3: 94,266,652 H322Q possibly damaging Het
Heatr5b C T 17: 78,766,875 probably null Het
Iqgap3 A G 3: 88,115,908 E502G probably benign Het
Klc1 T C 12: 111,795,627 V577A possibly damaging Het
Lck T C 4: 129,551,638 probably null Het
Mc3r C A 2: 172,249,690 Y277* probably null Het
Mlxipl T C 5: 135,133,604 V640A probably benign Het
Mrc2 A T 11: 105,332,343 N471Y probably damaging Het
Ncan T A 8: 70,102,017 H1050L probably damaging Het
Nrl C A 14: 55,522,432 V13F probably damaging Het
Obscn T A 11: 59,076,256 Y546F probably damaging Het
Olfr654 T G 7: 104,587,890 S46A probably benign Het
Olfr799 A G 10: 129,648,091 probably null Het
Pde3b G A 7: 114,521,692 G684D probably damaging Het
Prkaa1 C T 15: 5,174,342 T244I probably benign Het
Scfd2 A T 5: 74,206,398 probably null Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Smg1 A T 7: 118,145,590 V3113D possibly damaging Het
Sorbs1 T C 19: 40,376,881 T153A probably benign Het
Spag16 A G 1: 69,870,289 T182A probably benign Het
Svs2 T C 2: 164,237,669 K106R possibly damaging Het
Tenm1 A G X: 43,074,695 V107A possibly damaging Het
Topaz1 A T 9: 122,799,485 I1546F possibly damaging Het
Tubgcp2 C A 7: 140,032,225 E78* probably null Het
Vars A G 17: 35,005,481 probably null Het
Vmn2r109 A T 17: 20,554,305 W263R probably benign Het
Other mutations in Olfr214
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00951:Olfr214 APN 6 116557066 missense probably benign
IGL01837:Olfr214 APN 6 116556846 nonsense probably null
IGL02523:Olfr214 APN 6 116557093 missense probably benign 0.03
R0027:Olfr214 UTSW 6 116556949 missense probably damaging 0.99
R0616:Olfr214 UTSW 6 116556928 missense probably benign 0.00
R1121:Olfr214 UTSW 6 116557229 missense probably damaging 0.99
R1555:Olfr214 UTSW 6 116556826 missense probably damaging 1.00
R1691:Olfr214 UTSW 6 116556577 missense probably benign 0.00
R2196:Olfr214 UTSW 6 116556617 missense probably damaging 0.99
R3080:Olfr214 UTSW 6 116557217 missense probably damaging 0.98
R5416:Olfr214 UTSW 6 116557205 missense probably damaging 1.00
R6848:Olfr214 UTSW 6 116556775 missense probably damaging 0.98
R7425:Olfr214 UTSW 6 116556437 missense possibly damaging 0.95
R8059:Olfr214 UTSW 6 116556473 missense possibly damaging 0.47
R8349:Olfr214 UTSW 6 116557328 missense probably damaging 0.99
R8449:Olfr214 UTSW 6 116557328 missense probably damaging 0.99
R8551:Olfr214 UTSW 6 116557328 missense probably damaging 0.99
R8552:Olfr214 UTSW 6 116557328 missense probably damaging 0.99
R8553:Olfr214 UTSW 6 116557328 missense probably damaging 0.99
R8555:Olfr214 UTSW 6 116557328 missense probably damaging 0.99
R8988:Olfr214 UTSW 6 116557294 missense possibly damaging 0.89
R9720:Olfr214 UTSW 6 116557055 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- TTCATCCTAGTAACCGGTGTG -3'
(R):5'- TTCAGAAGCGGCGTCACTAC -3'

Sequencing Primer
(F):5'- CATCCTAGTAACCGGTGTGATTCTG -3'
(R):5'- GGCGTCACTACCGTGTTTAC -3'
Posted On 2017-01-03