Mutagenetix > Incidental Mutations

Incidental Mutation 'R5706:Olfr214'

451971

Institutional Source

Beutler Lab

Gene Symbol

Olfr214

Ensembl Gene

ENSMUSG00000051046

Gene Name

olfactory receptor 214

Synonyms

MOR119-1, GA_x54KRFPKN04-58190962-58191900

MMRRC Submission

043331-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.187) question?

Stock #

R5706 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

116554235-116560611 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 116557113 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Methionine at position 229 (I229M)

Ref Sequence

ENSEMBL: ENSMUSP00000150737 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000060204] [ENSMUST00000122096] [ENSMUST00000203867] [ENSMUST00000214699] [ENSMUST00000215846] [ENSMUST00000217313]

Predicted Effect

probably damaging
Transcript: ENSMUST00000060204
AA Change: I229M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000052730
Gene: ENSMUSG00000051046
AA Change: I229M

Domain	Start	End	E-Value	Type
Pfam:7tm_4	39	316	4.7e-47	PFAM
Pfam:7tm_1	49	298	5.9e-17	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000122096

SMART Domains

Protein: ENSMUSP00000145194
Gene: ENSMUSG00000107906

Domain	Start	End	E-Value	Type
DEXDc	57	254	2.4e-59	SMART
HELICc	291	372	6.6e-38	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000203867
AA Change: I229M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000145465
Gene: ENSMUSG00000051046
AA Change: I229M

Domain	Start	End	E-Value	Type
Pfam:7tm_4	39	316	4.7e-47	PFAM
Pfam:7tm_1	49	298	5.9e-17	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000214699
AA Change: I229M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000215846
AA Change: I229M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000217313
AA Change: I229M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca4	T	A	3: 122,054,261	M77K	probably benign	Het
Amy1	A	G	3: 113,556,120	V467A	probably damaging	Het
Atf4	T	C	15: 80,256,330	V11A	possibly damaging	Het
B4galt1	T	C	4: 40,807,268	N373D	probably damaging	Het
Bpifa3	A	G	2: 154,135,578	K112R	probably damaging	Het
Chd2	T	A	7: 73,491,357	Y596F	possibly damaging	Het
Clspn	T	C	4: 126,578,418	S962P	probably damaging	Het
Cyp2c68	T	C	19: 39,734,318	D262G	possibly damaging	Het
Dcaf11	T	C	14: 55,565,695	I282T	probably damaging	Het
Dmxl1	T	C	18: 49,957,395		probably null	Het
Dnah11	T	G	12: 118,023,935	K2411Q	probably damaging	Het
Elf3	A	G	1: 135,256,482	V196A	probably benign	Het
Fhad1	T	G	4: 141,954,116	T538P	probably damaging	Het
Fkbp10	A	G	11: 100,421,023	D174G	probably damaging	Het
Gas6	A	G	8: 13,477,098	S217P	probably damaging	Het
Gm4778	T	A	3: 94,266,652	H322Q	possibly damaging	Het
Heatr5b	C	T	17: 78,766,875		probably null	Het
Iqgap3	A	G	3: 88,115,908	E502G	probably benign	Het
Klc1	T	C	12: 111,795,627	V577A	possibly damaging	Het
Lck	T	C	4: 129,551,638		probably null	Het
Mc3r	C	A	2: 172,249,690	Y277*	probably null	Het
Mlxipl	T	C	5: 135,133,604	V640A	probably benign	Het
Mrc2	A	T	11: 105,332,343	N471Y	probably damaging	Het
Ncan	T	A	8: 70,102,017	H1050L	probably damaging	Het
Nrl	C	A	14: 55,522,432	V13F	probably damaging	Het
Obscn	T	A	11: 59,076,256	Y546F	probably damaging	Het
Olfr654	T	G	7: 104,587,890	S46A	probably benign	Het
Olfr799	A	G	10: 129,648,091		probably null	Het
Pde3b	G	A	7: 114,521,692	G684D	probably damaging	Het
Prkaa1	C	T	15: 5,174,342	T244I	probably benign	Het
Scfd2	A	T	5: 74,206,398		probably null	Het
Slc22a30	G	A	19: 8,344,393	Q436*	probably null	Het
Smg1	A	T	7: 118,145,590	V3113D	possibly damaging	Het
Sorbs1	T	C	19: 40,376,881	T153A	probably benign	Het
Spag16	A	G	1: 69,870,289	T182A	probably benign	Het
Svs2	T	C	2: 164,237,669	K106R	possibly damaging	Het
Tenm1	A	G	X: 43,074,695	V107A	possibly damaging	Het
Topaz1	A	T	9: 122,799,485	I1546F	possibly damaging	Het
Tubgcp2	C	A	7: 140,032,225	E78*	probably null	Het
Vars	A	G	17: 35,005,481		probably null	Het
Vmn2r109	A	T	17: 20,554,305	W263R	probably benign	Het

Other mutations in Olfr214

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00951:Olfr214	APN	6	116557066	missense	probably benign
IGL01837:Olfr214	APN	6	116556846	nonsense	probably null
IGL02523:Olfr214	APN	6	116557093	missense	probably benign	0.03
R0027:Olfr214	UTSW	6	116556949	missense	probably damaging	0.99
R0616:Olfr214	UTSW	6	116556928	missense	probably benign	0.00
R1121:Olfr214	UTSW	6	116557229	missense	probably damaging	0.99
R1555:Olfr214	UTSW	6	116556826	missense	probably damaging	1.00
R1691:Olfr214	UTSW	6	116556577	missense	probably benign	0.00
R2196:Olfr214	UTSW	6	116556617	missense	probably damaging	0.99
R3080:Olfr214	UTSW	6	116557217	missense	probably damaging	0.98
R5416:Olfr214	UTSW	6	116557205	missense	probably damaging	1.00
R6848:Olfr214	UTSW	6	116556775	missense	probably damaging	0.98
R7425:Olfr214	UTSW	6	116556437	missense	possibly damaging	0.95
R8059:Olfr214	UTSW	6	116556473	missense	possibly damaging	0.47
R8349:Olfr214	UTSW	6	116557328	missense	probably damaging	0.99
R8449:Olfr214	UTSW	6	116557328	missense	probably damaging	0.99
R8551:Olfr214	UTSW	6	116557328	missense	probably damaging	0.99
R8552:Olfr214	UTSW	6	116557328	missense	probably damaging	0.99
R8553:Olfr214	UTSW	6	116557328	missense	probably damaging	0.99
R8555:Olfr214	UTSW	6	116557328	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TTCATCCTAGTAACCGGTGTG -3'
(R):5'- TTCAGAAGCGGCGTCACTAC -3'

Sequencing Primer
(F):5'- CATCCTAGTAACCGGTGTGATTCTG -3'
(R):5'- GGCGTCACTACCGTGTTTAC -3'

Posted On

2017-01-03