Mutagenetix > Incidental Mutation

Incidental Mutation 'R5706:Chd2'

451972

Institutional Source

Beutler Lab

Gene Symbol

Chd2

Ensembl Gene

ENSMUSG00000078671

Gene Name

chromodomain helicase DNA binding protein 2

Synonyms

2810040A01Rik, 2810013C04Rik, 5630401D06Rik

MMRRC Submission

043331-MU

Accession Numbers

Genbank: NM_001081345; Ensembl: ENSMUST00000169922; MGI: 2448567

Essential gene?

Possibly essential (E-score: 0.615) question?

Stock #

R5706 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

73426638-73541830 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 73491357 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Phenylalanine at position 596 (Y596F)

Ref Sequence

ENSEMBL: ENSMUSP00000126352 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000169922]

AlphaFold

E9PZM4

Predicted Effect

possibly damaging
Transcript: ENSMUST00000169922
AA Change: Y596F

PolyPhen 2 Score 0.742 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000126352
Gene: ENSMUSG00000078671
AA Change: Y596F

Domain	Start	End	E-Value	Type
low complexity region	13	75	N/A	INTRINSIC
low complexity region	80	91	N/A	INTRINSIC
low complexity region	126	136	N/A	INTRINSIC
low complexity region	176	196	N/A	INTRINSIC
low complexity region	235	244	N/A	INTRINSIC
CHROMO	260	346	3.64e-19	SMART
CHROMO	376	449	7.99e-16	SMART
DEXDc	480	677	1.93e-37	SMART
Blast:DEXDc	678	729	2e-18	BLAST
low complexity region	793	806	N/A	INTRINSIC
HELICc	821	905	1.2e-24	SMART
Blast:DEXDc	960	1244	4e-63	BLAST
PDB:4B4C\|A	1128	1316	5e-78	PDB
low complexity region	1317	1329	N/A	INTRINSIC
low complexity region	1338	1351	N/A	INTRINSIC
low complexity region	1389	1403	N/A	INTRINSIC
low complexity region	1407	1441	N/A	INTRINSIC
DUF4208	1451	1555	1.85e-52	SMART
low complexity region	1557	1572	N/A	INTRINSIC
low complexity region	1704	1729	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The CHD family of proteins is characterized by the presence of chromo (chromatin organization modifier) domains and SNF2-related helicase/ATPase domains. CHD genes alter gene expression possibly by modification of chromatin structure thus altering access of the transcriptional apparatus to its chromosomal DNA template. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit early postnatal lethality associated with fetal growth retardation. Mice heterozygous for a gene trap allele exhibit postnatal lethality and premature death after weaning associated with growth retardation and multi-organ defects. [provided by MGI curators]

Allele List at MGI

All alleles(169) : Targeted, knock-out(1) Gene trapped(168)

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca4	T	A	3: 122,054,261	M77K	probably benign	Het
Amy1	A	G	3: 113,556,120	V467A	probably damaging	Het
Atf4	T	C	15: 80,256,330	V11A	possibly damaging	Het
B4galt1	T	C	4: 40,807,268	N373D	probably damaging	Het
Bpifa3	A	G	2: 154,135,578	K112R	probably damaging	Het
Clspn	T	C	4: 126,578,418	S962P	probably damaging	Het
Cyp2c68	T	C	19: 39,734,318	D262G	possibly damaging	Het
Dcaf11	T	C	14: 55,565,695	I282T	probably damaging	Het
Dmxl1	T	C	18: 49,957,395		probably null	Het
Dnah11	T	G	12: 118,023,935	K2411Q	probably damaging	Het
Elf3	A	G	1: 135,256,482	V196A	probably benign	Het
Fhad1	T	G	4: 141,954,116	T538P	probably damaging	Het
Fkbp10	A	G	11: 100,421,023	D174G	probably damaging	Het
Gas6	A	G	8: 13,477,098	S217P	probably damaging	Het
Gm4778	T	A	3: 94,266,652	H322Q	possibly damaging	Het
Heatr5b	C	T	17: 78,766,875		probably null	Het
Iqgap3	A	G	3: 88,115,908	E502G	probably benign	Het
Klc1	T	C	12: 111,795,627	V577A	possibly damaging	Het
Lck	T	C	4: 129,551,638		probably null	Het
Mc3r	C	A	2: 172,249,690	Y277*	probably null	Het
Mlxipl	T	C	5: 135,133,604	V640A	probably benign	Het
Mrc2	A	T	11: 105,332,343	N471Y	probably damaging	Het
Ncan	T	A	8: 70,102,017	H1050L	probably damaging	Het
Nrl	C	A	14: 55,522,432	V13F	probably damaging	Het
Obscn	T	A	11: 59,076,256	Y546F	probably damaging	Het
Olfr214	A	G	6: 116,557,113	I229M	probably damaging	Het
Olfr654	T	G	7: 104,587,890	S46A	probably benign	Het
Olfr799	A	G	10: 129,648,091		probably null	Het
Pde3b	G	A	7: 114,521,692	G684D	probably damaging	Het
Prkaa1	C	T	15: 5,174,342	T244I	probably benign	Het
Scfd2	A	T	5: 74,206,398		probably null	Het
Slc22a30	G	A	19: 8,344,393	Q436*	probably null	Het
Smg1	A	T	7: 118,145,590	V3113D	possibly damaging	Het
Sorbs1	T	C	19: 40,376,881	T153A	probably benign	Het
Spag16	A	G	1: 69,870,289	T182A	probably benign	Het
Svs2	T	C	2: 164,237,669	K106R	possibly damaging	Het
Tenm1	A	G	X: 43,074,695	V107A	possibly damaging	Het
Topaz1	A	T	9: 122,799,485	I1546F	possibly damaging	Het
Tubgcp2	C	A	7: 140,032,225	E78*	probably null	Het
Vars	A	G	17: 35,005,481		probably null	Het
Vmn2r109	A	T	17: 20,554,305	W263R	probably benign	Het

Other mutations in Chd2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00232:Chd2	APN	7	73468577	missense	probably damaging	0.99
IGL00535:Chd2	APN	7	73540828	missense	probably benign	0.01
IGL00961:Chd2	APN	7	73444249	missense	probably damaging	0.99
IGL01092:Chd2	APN	7	73441686	missense	possibly damaging	0.69
IGL02035:Chd2	APN	7	73441627	splice site	probably null
IGL02083:Chd2	APN	7	73481068	missense	possibly damaging	0.95
IGL02205:Chd2	APN	7	73441717	missense	probably benign	0.01
IGL02243:Chd2	APN	7	73497708	splice site	probably null
IGL02385:Chd2	APN	7	73435822	missense	probably damaging	1.00
IGL02552:Chd2	APN	7	73447320	unclassified	probably benign
IGL02590:Chd2	APN	7	73453200	missense	probably benign	0.00
IGL02684:Chd2	APN	7	73475349	missense	probably damaging	0.99
IGL02731:Chd2	APN	7	73493456	missense	probably damaging	0.99
IGL03272:Chd2	APN	7	73453166	missense	possibly damaging	0.94
1mM(1):Chd2	UTSW	7	73502104	missense	possibly damaging	0.65
A4554:Chd2	UTSW	7	73480968	missense	probably benign
F6893:Chd2	UTSW	7	73507872	missense	possibly damaging	0.92
R0012:Chd2	UTSW	7	73455519	missense	probably damaging	1.00
R0012:Chd2	UTSW	7	73455519	missense	probably damaging	1.00
R0068:Chd2	UTSW	7	73484534	missense	probably damaging	1.00
R0763:Chd2	UTSW	7	73447274	missense	possibly damaging	0.74
R0973:Chd2	UTSW	7	73478664	missense	probably damaging	1.00
R0973:Chd2	UTSW	7	73478664	missense	probably damaging	1.00
R0974:Chd2	UTSW	7	73478664	missense	probably damaging	1.00
R1223:Chd2	UTSW	7	73484517	missense	probably damaging	1.00
R1435:Chd2	UTSW	7	73453136	missense	probably damaging	0.99
R1527:Chd2	UTSW	7	73490614	nonsense	probably null
R1599:Chd2	UTSW	7	73473051	missense	probably benign	0.05
R1657:Chd2	UTSW	7	73480430	missense	probably damaging	1.00
R1932:Chd2	UTSW	7	73454445	missense	probably damaging	0.99
R2110:Chd2	UTSW	7	73429987	missense	probably benign	0.00
R2202:Chd2	UTSW	7	73478668	missense	probably benign	0.00
R2383:Chd2	UTSW	7	73503420	missense	possibly damaging	0.89
R2393:Chd2	UTSW	7	73507883	missense	possibly damaging	0.92
R3699:Chd2	UTSW	7	73468490	missense	probably benign	0.35
R3713:Chd2	UTSW	7	73471790	unclassified	probably benign
R3788:Chd2	UTSW	7	73447130	unclassified	probably benign
R3826:Chd2	UTSW	7	73491415	missense	possibly damaging	0.71
R3828:Chd2	UTSW	7	73491415	missense	possibly damaging	0.71
R3830:Chd2	UTSW	7	73491415	missense	possibly damaging	0.71
R3966:Chd2	UTSW	7	73464395	splice site	probably benign
R4093:Chd2	UTSW	7	73501016	missense	possibly damaging	0.70
R4431:Chd2	UTSW	7	73435961	missense	possibly damaging	0.56
R4461:Chd2	UTSW	7	73540874	intron	probably benign
R4782:Chd2	UTSW	7	73484436	missense	possibly damaging	0.80
R4791:Chd2	UTSW	7	73468577	missense	probably benign	0.13
R4792:Chd2	UTSW	7	73468577	missense	probably benign	0.13
R4799:Chd2	UTSW	7	73484436	missense	possibly damaging	0.80
R4832:Chd2	UTSW	7	73502125	missense	probably damaging	1.00
R5055:Chd2	UTSW	7	73480508	missense	probably damaging	1.00
R5071:Chd2	UTSW	7	73429689	missense	probably benign	0.03
R5328:Chd2	UTSW	7	73463681	missense	possibly damaging	0.96
R5444:Chd2	UTSW	7	73473085	missense	probably damaging	1.00
R5643:Chd2	UTSW	7	73484484	missense	probably damaging	1.00
R5666:Chd2	UTSW	7	73441717	missense	probably benign	0.01
R5670:Chd2	UTSW	7	73441717	missense	probably benign	0.01
R5825:Chd2	UTSW	7	73484602	splice site	probably null
R5834:Chd2	UTSW	7	73478715	missense	probably damaging	1.00
R5920:Chd2	UTSW	7	73537312	missense	probably damaging	0.97
R6051:Chd2	UTSW	7	73435842	missense	probably benign	0.00
R6179:Chd2	UTSW	7	73444323	missense	probably damaging	0.98
R6229:Chd2	UTSW	7	73451723	missense	possibly damaging	0.76
R6267:Chd2	UTSW	7	73463671	missense	probably damaging	0.99
R6310:Chd2	UTSW	7	73453164	missense	probably damaging	1.00
R6439:Chd2	UTSW	7	73480406	missense	probably damaging	1.00
R6444:Chd2	UTSW	7	73501037	critical splice acceptor site	probably null
R6529:Chd2	UTSW	7	73503443	missense	possibly damaging	0.89
R6611:Chd2	UTSW	7	73493565	missense	probably damaging	0.99
R6661:Chd2	UTSW	7	73490482	missense	possibly damaging	0.95
R6782:Chd2	UTSW	7	73475379	nonsense	probably null
R6860:Chd2	UTSW	7	73497810	missense	possibly damaging	0.95
R6955:Chd2	UTSW	7	73475423	missense	probably damaging	1.00
R6984:Chd2	UTSW	7	73484411	nonsense	probably null
R7095:Chd2	UTSW	7	73471881	missense	probably damaging	1.00
R7121:Chd2	UTSW	7	73469670	missense	probably benign	0.00
R7179:Chd2	UTSW	7	73475420	missense	probably damaging	1.00
R7500:Chd2	UTSW	7	73451808	missense	probably damaging	1.00
R7615:Chd2	UTSW	7	73441642	missense	probably damaging	0.97
R7646:Chd2	UTSW	7	73435773	missense	possibly damaging	0.49
R7764:Chd2	UTSW	7	73471819	missense	probably null	1.00
R7898:Chd2	UTSW	7	73519475	critical splice donor site	probably null
R7935:Chd2	UTSW	7	73499625	missense	probably benign	0.01
R8033:Chd2	UTSW	7	73435880	missense	probably damaging	1.00
R8070:Chd2	UTSW	7	73451758	missense	probably benign
R8071:Chd2	UTSW	7	73537384	missense	probably benign
R8188:Chd2	UTSW	7	73429756	nonsense	probably null
R8196:Chd2	UTSW	7	73468537	missense	probably benign	0.00
R8258:Chd2	UTSW	7	73435784	missense	probably benign	0.11
R8259:Chd2	UTSW	7	73435784	missense	probably benign	0.11
R8357:Chd2	UTSW	7	73447237	missense	probably damaging	0.99
R8457:Chd2	UTSW	7	73447237	missense	probably damaging	0.99
R8778:Chd2	UTSW	7	73429735	missense	possibly damaging	0.88
R8816:Chd2	UTSW	7	73490497	missense	probably damaging	1.00
R8875:Chd2	UTSW	7	73502035	missense	probably damaging	1.00
R8935:Chd2	UTSW	7	73503462	missense	possibly damaging	0.47
R9005:Chd2	UTSW	7	73484546	missense	probably damaging	0.98
R9009:Chd2	UTSW	7	73490654	missense	probably benign	0.12
R9009:Chd2	UTSW	7	73493444	missense	probably benign	0.39
R9021:Chd2	UTSW	7	73441645	missense	probably benign	0.03
R9038:Chd2	UTSW	7	73455610	missense	probably damaging	1.00
R9064:Chd2	UTSW	7	73493531	missense	possibly damaging	0.70
R9383:Chd2	UTSW	7	73449170	missense	probably null	1.00
R9501:Chd2	UTSW	7	73441733	missense	possibly damaging	0.92
R9501:Chd2	UTSW	7	73480546	missense	probably damaging	1.00
R9550:Chd2	UTSW	7	73469691	missense	probably damaging	0.99
R9583:Chd2	UTSW	7	73480482	missense	probably damaging	0.99
R9665:Chd2	UTSW	7	73429807	missense	probably benign	0.00
RF009:Chd2	UTSW	7	73519662	missense	possibly damaging	0.73
X0025:Chd2	UTSW	7	73507837	missense	probably benign	0.11
Z1177:Chd2	UTSW	7	73468586	missense	possibly damaging	0.48

Predicted Primers

PCR Primer
(F):5'- TTGCAACTGGATTAAGCCACC -3'
(R):5'- GGTTGTTCATGCAATTCTCATGAG -3'

Sequencing Primer
(F):5'- CTAAGCTCCCATACGGTGAGGTTG -3'
(R):5'- GCAATTCTCATGAGACTTGTTTGC -3'

Posted On

2017-01-03