Incidental Mutation 'R5706:Olfr654'
ID 451974
Institutional Source Beutler Lab
Gene Symbol Olfr654
Ensembl Gene ENSMUSG00000073925
Gene Name olfactory receptor 654
Synonyms GA_x6K02T2PBJ9-7215221-7216195, MOR38-2
MMRRC Submission 043331-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.059) question?
Stock # R5706 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 104587025-104590718 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 104587890 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Alanine at position 46 (S46A)
Ref Sequence ENSEMBL: ENSMUSP00000095775 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098173] [ENSMUST00000210457] [ENSMUST00000213984] [ENSMUST00000215585] [ENSMUST00000217466]
AlphaFold Q8VF27
Predicted Effect probably benign
Transcript: ENSMUST00000098173
AA Change: S46A

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000095775
Gene: ENSMUSG00000073925
AA Change: S46A

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
Pfam:7TM_GPCR_Srbc 43 176 2.5e-8 PFAM
Pfam:7tm_4 49 328 1.7e-103 PFAM
Pfam:7TM_GPCR_Srsx 53 325 1.6e-7 PFAM
Pfam:7tm_1 59 310 9.2e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000210457
AA Change: S29A

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
Predicted Effect probably benign
Transcript: ENSMUST00000213984
AA Change: S29A

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
Predicted Effect probably benign
Transcript: ENSMUST00000215585
Predicted Effect probably benign
Transcript: ENSMUST00000217466
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T A 3: 122,054,261 M77K probably benign Het
Amy1 A G 3: 113,556,120 V467A probably damaging Het
Atf4 T C 15: 80,256,330 V11A possibly damaging Het
B4galt1 T C 4: 40,807,268 N373D probably damaging Het
Bpifa3 A G 2: 154,135,578 K112R probably damaging Het
Chd2 T A 7: 73,491,357 Y596F possibly damaging Het
Clspn T C 4: 126,578,418 S962P probably damaging Het
Cyp2c68 T C 19: 39,734,318 D262G possibly damaging Het
Dcaf11 T C 14: 55,565,695 I282T probably damaging Het
Dmxl1 T C 18: 49,957,395 probably null Het
Dnah11 T G 12: 118,023,935 K2411Q probably damaging Het
Elf3 A G 1: 135,256,482 V196A probably benign Het
Fhad1 T G 4: 141,954,116 T538P probably damaging Het
Fkbp10 A G 11: 100,421,023 D174G probably damaging Het
Gas6 A G 8: 13,477,098 S217P probably damaging Het
Gm4778 T A 3: 94,266,652 H322Q possibly damaging Het
Heatr5b C T 17: 78,766,875 probably null Het
Iqgap3 A G 3: 88,115,908 E502G probably benign Het
Klc1 T C 12: 111,795,627 V577A possibly damaging Het
Lck T C 4: 129,551,638 probably null Het
Mc3r C A 2: 172,249,690 Y277* probably null Het
Mlxipl T C 5: 135,133,604 V640A probably benign Het
Mrc2 A T 11: 105,332,343 N471Y probably damaging Het
Ncan T A 8: 70,102,017 H1050L probably damaging Het
Nrl C A 14: 55,522,432 V13F probably damaging Het
Obscn T A 11: 59,076,256 Y546F probably damaging Het
Olfr214 A G 6: 116,557,113 I229M probably damaging Het
Olfr799 A G 10: 129,648,091 probably null Het
Pde3b G A 7: 114,521,692 G684D probably damaging Het
Prkaa1 C T 15: 5,174,342 T244I probably benign Het
Scfd2 A T 5: 74,206,398 probably null Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Smg1 A T 7: 118,145,590 V3113D possibly damaging Het
Sorbs1 T C 19: 40,376,881 T153A probably benign Het
Spag16 A G 1: 69,870,289 T182A probably benign Het
Svs2 T C 2: 164,237,669 K106R possibly damaging Het
Tenm1 A G X: 43,074,695 V107A possibly damaging Het
Topaz1 A T 9: 122,799,485 I1546F possibly damaging Het
Tubgcp2 C A 7: 140,032,225 E78* probably null Het
Vars A G 17: 35,005,481 probably null Het
Vmn2r109 A T 17: 20,554,305 W263R probably benign Het
Other mutations in Olfr654
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01481:Olfr654 APN 7 104587860 missense probably damaging 1.00
IGL01677:Olfr654 APN 7 104588145 missense probably damaging 0.97
IGL01807:Olfr654 APN 7 104587884 missense probably damaging 1.00
IGL03113:Olfr654 APN 7 104588733 missense probably benign 0.01
R0504:Olfr654 UTSW 7 104588475 nonsense probably null
R0647:Olfr654 UTSW 7 104588115 missense probably damaging 1.00
R0941:Olfr654 UTSW 7 104588338 missense probably damaging 1.00
R0945:Olfr654 UTSW 7 104588672 missense probably damaging 1.00
R1423:Olfr654 UTSW 7 104588475 nonsense probably null
R1860:Olfr654 UTSW 7 104587905 missense probably damaging 0.98
R2872:Olfr654 UTSW 7 104588493 missense possibly damaging 0.87
R2872:Olfr654 UTSW 7 104588493 missense possibly damaging 0.87
R4082:Olfr654 UTSW 7 104588623 missense probably damaging 1.00
R4760:Olfr654 UTSW 7 104588489 missense probably benign 0.32
R4787:Olfr654 UTSW 7 104587960 missense probably benign
R4969:Olfr654 UTSW 7 104588523 missense probably damaging 1.00
R5186:Olfr654 UTSW 7 104588211 missense probably damaging 1.00
R6582:Olfr654 UTSW 7 104588011 missense probably damaging 1.00
R7076:Olfr654 UTSW 7 104588223 missense probably damaging 1.00
R7155:Olfr654 UTSW 7 104588557 missense possibly damaging 0.88
R7424:Olfr654 UTSW 7 104588700 missense probably damaging 1.00
R7559:Olfr654 UTSW 7 104587880 missense probably damaging 1.00
R7722:Olfr654 UTSW 7 104588298 missense possibly damaging 0.77
Z1177:Olfr654 UTSW 7 104588004 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGTGCCTGGCTGCTTAAC -3'
(R):5'- ATGCAGAGCACCTTAGGAATGG -3'

Sequencing Primer
(F):5'- AGTGCCTGGCTGCTTAACATATAC -3'
(R):5'- CACCTTAGGAATGGTGGTCGTAGAC -3'
Posted On 2017-01-03