Incidental Mutation 'R5706:Tubgcp2'
ID 451977
Institutional Source Beutler Lab
Gene Symbol Tubgcp2
Ensembl Gene ENSMUSG00000025474
Gene Name tubulin, gamma complex component 2
Synonyms 1700022B05Rik
MMRRC Submission 043331-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.947) question?
Stock # R5706 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 139575868-139616582 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) C to A at 139612138 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 78 (E78*)
Ref Sequence ENSEMBL: ENSMUSP00000147766 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026547] [ENSMUST00000168194] [ENSMUST00000209574] [ENSMUST00000210224] [ENSMUST00000211261] [ENSMUST00000211638] [ENSMUST00000211789]
AlphaFold Q921G8
Predicted Effect probably benign
Transcript: ENSMUST00000026547
AA Change: R58L

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000026547
Gene: ENSMUSG00000025474
AA Change: R58L

DomainStartEndE-ValueType
low complexity region 109 121 N/A INTRINSIC
Pfam:Spc97_Spc98 220 738 8.6e-123 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168194
SMART Domains Protein: ENSMUSP00000129154
Gene: ENSMUSG00000025470

DomainStartEndE-ValueType
low complexity region 32 45 N/A INTRINSIC
ZnF_C2H2 80 105 4.23e0 SMART
ZnF_C2H2 107 130 1.36e1 SMART
ZnF_C2H2 144 169 3.52e-1 SMART
low complexity region 186 205 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000209574
AA Change: R58L

PolyPhen 2 Score 0.782 (Sensitivity: 0.85; Specificity: 0.93)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209930
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210089
Predicted Effect probably damaging
Transcript: ENSMUST00000210224
AA Change: R58L

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210419
Predicted Effect probably benign
Transcript: ENSMUST00000210882
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210936
Predicted Effect probably null
Transcript: ENSMUST00000211261
AA Change: E78*
Predicted Effect possibly damaging
Transcript: ENSMUST00000211638
AA Change: R58L

PolyPhen 2 Score 0.679 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211186
Predicted Effect probably benign
Transcript: ENSMUST00000211789
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T A 3: 121,847,910 (GRCm39) M77K probably benign Het
Amy1 A G 3: 113,349,769 (GRCm39) V467A probably damaging Het
Atf4 T C 15: 80,140,531 (GRCm39) V11A possibly damaging Het
B4galt1 T C 4: 40,807,268 (GRCm39) N373D probably damaging Het
Bpifa3 A G 2: 153,977,498 (GRCm39) K112R probably damaging Het
Chd2 T A 7: 73,141,105 (GRCm39) Y596F possibly damaging Het
Clspn T C 4: 126,472,211 (GRCm39) S962P probably damaging Het
Cyp2c68 T C 19: 39,722,762 (GRCm39) D262G possibly damaging Het
Dcaf11 T C 14: 55,803,152 (GRCm39) I282T probably damaging Het
Dmxl1 T C 18: 50,090,462 (GRCm39) probably null Het
Dnah11 T G 12: 117,987,670 (GRCm39) K2411Q probably damaging Het
Elf3 A G 1: 135,184,220 (GRCm39) V196A probably benign Het
Fhad1 T G 4: 141,681,427 (GRCm39) T538P probably damaging Het
Fkbp10 A G 11: 100,311,849 (GRCm39) D174G probably damaging Het
Gas6 A G 8: 13,527,098 (GRCm39) S217P probably damaging Het
Heatr5b C T 17: 79,074,304 (GRCm39) probably null Het
Iqgap3 A G 3: 88,023,215 (GRCm39) E502G probably benign Het
Klc1 T C 12: 111,762,061 (GRCm39) V577A possibly damaging Het
Lck T C 4: 129,445,431 (GRCm39) probably null Het
Mc3r C A 2: 172,091,610 (GRCm39) Y277* probably null Het
Mlxipl T C 5: 135,162,458 (GRCm39) V640A probably benign Het
Mrc2 A T 11: 105,223,169 (GRCm39) N471Y probably damaging Het
Ncan T A 8: 70,554,667 (GRCm39) H1050L probably damaging Het
Nrl C A 14: 55,759,889 (GRCm39) V13F probably damaging Het
Obscn T A 11: 58,967,082 (GRCm39) Y546F probably damaging Het
Or52u1 T G 7: 104,237,097 (GRCm39) S46A probably benign Het
Or6c209 A G 10: 129,483,960 (GRCm39) probably null Het
Or6d14 A G 6: 116,534,074 (GRCm39) I229M probably damaging Het
Pde3b G A 7: 114,120,927 (GRCm39) G684D probably damaging Het
Prkaa1 C T 15: 5,203,823 (GRCm39) T244I probably benign Het
Scfd2 A T 5: 74,367,059 (GRCm39) probably null Het
Slc22a30 G A 19: 8,321,757 (GRCm39) Q436* probably null Het
Smg1 A T 7: 117,744,813 (GRCm39) V3113D possibly damaging Het
Sorbs1 T C 19: 40,365,325 (GRCm39) T153A probably benign Het
Spag16 A G 1: 69,909,448 (GRCm39) T182A probably benign Het
Spopfm1 T A 3: 94,173,959 (GRCm39) H322Q possibly damaging Het
Svs5 T C 2: 164,079,589 (GRCm39) K106R possibly damaging Het
Tenm1 A G X: 42,163,572 (GRCm39) V107A possibly damaging Het
Topaz1 A T 9: 122,628,550 (GRCm39) I1546F possibly damaging Het
Vars1 A G 17: 35,224,457 (GRCm39) probably null Het
Vmn2r109 A T 17: 20,774,567 (GRCm39) W263R probably benign Het
Other mutations in Tubgcp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Tubgcp2 APN 7 139,610,935 (GRCm39) missense possibly damaging 0.58
IGL00791:Tubgcp2 APN 7 139,581,411 (GRCm39) missense probably damaging 0.97
IGL02643:Tubgcp2 APN 7 139,576,067 (GRCm39) missense probably damaging 1.00
IGL02710:Tubgcp2 APN 7 139,584,897 (GRCm39) splice site probably benign
IGL03352:Tubgcp2 APN 7 139,580,940 (GRCm39) missense probably benign 0.01
R0189:Tubgcp2 UTSW 7 139,581,518 (GRCm39) splice site probably benign
R0333:Tubgcp2 UTSW 7 139,579,260 (GRCm39) missense probably damaging 1.00
R0379:Tubgcp2 UTSW 7 139,612,105 (GRCm39) missense probably damaging 1.00
R1051:Tubgcp2 UTSW 7 139,578,809 (GRCm39) missense probably benign 0.26
R1192:Tubgcp2 UTSW 7 139,609,751 (GRCm39) missense probably benign
R1528:Tubgcp2 UTSW 7 139,613,696 (GRCm39) unclassified probably benign
R1728:Tubgcp2 UTSW 7 139,577,968 (GRCm39) missense probably benign
R1729:Tubgcp2 UTSW 7 139,577,968 (GRCm39) missense probably benign
R1784:Tubgcp2 UTSW 7 139,577,968 (GRCm39) missense probably benign
R1888:Tubgcp2 UTSW 7 139,586,069 (GRCm39) missense probably damaging 1.00
R1888:Tubgcp2 UTSW 7 139,586,069 (GRCm39) missense probably damaging 1.00
R1888:Tubgcp2 UTSW 7 139,579,183 (GRCm39) missense probably damaging 1.00
R1888:Tubgcp2 UTSW 7 139,579,183 (GRCm39) missense probably damaging 1.00
R1967:Tubgcp2 UTSW 7 139,586,066 (GRCm39) missense probably benign 0.09
R4514:Tubgcp2 UTSW 7 139,575,984 (GRCm39) missense possibly damaging 0.51
R4545:Tubgcp2 UTSW 7 139,575,984 (GRCm39) missense possibly damaging 0.51
R4774:Tubgcp2 UTSW 7 139,576,074 (GRCm39) missense probably damaging 1.00
R4790:Tubgcp2 UTSW 7 139,579,201 (GRCm39) missense probably damaging 1.00
R5114:Tubgcp2 UTSW 7 139,587,354 (GRCm39) missense possibly damaging 0.91
R5435:Tubgcp2 UTSW 7 139,575,985 (GRCm39) missense possibly damaging 0.51
R5531:Tubgcp2 UTSW 7 139,584,937 (GRCm39) splice site probably null
R5699:Tubgcp2 UTSW 7 139,578,701 (GRCm39) missense possibly damaging 0.53
R6123:Tubgcp2 UTSW 7 139,587,510 (GRCm39) missense probably damaging 1.00
R7153:Tubgcp2 UTSW 7 139,580,949 (GRCm39) missense probably benign
R7165:Tubgcp2 UTSW 7 139,585,274 (GRCm39) missense probably damaging 0.99
R7213:Tubgcp2 UTSW 7 139,587,927 (GRCm39) missense probably benign 0.28
R7424:Tubgcp2 UTSW 7 139,587,837 (GRCm39) missense possibly damaging 0.65
R7511:Tubgcp2 UTSW 7 139,584,793 (GRCm39) missense probably benign 0.00
R7523:Tubgcp2 UTSW 7 139,586,783 (GRCm39) missense probably benign 0.08
R7612:Tubgcp2 UTSW 7 139,580,964 (GRCm39) missense probably damaging 1.00
R7951:Tubgcp2 UTSW 7 139,587,893 (GRCm39) missense possibly damaging 0.69
R8220:Tubgcp2 UTSW 7 139,586,053 (GRCm39) missense possibly damaging 0.92
R8481:Tubgcp2 UTSW 7 139,613,588 (GRCm39) missense probably damaging 1.00
R8717:Tubgcp2 UTSW 7 139,576,705 (GRCm39) missense probably benign
R8886:Tubgcp2 UTSW 7 139,584,882 (GRCm39) missense probably benign 0.04
R9222:Tubgcp2 UTSW 7 139,587,965 (GRCm39) missense probably damaging 1.00
R9603:Tubgcp2 UTSW 7 139,584,789 (GRCm39) missense probably benign 0.00
R9666:Tubgcp2 UTSW 7 139,587,836 (GRCm39) missense probably damaging 1.00
X0004:Tubgcp2 UTSW 7 139,586,934 (GRCm39) missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- ATGCCTTATGTGCATTTACATCTGC -3'
(R):5'- CGCGGACCATAGACATTAACTTG -3'

Sequencing Primer
(F):5'- TCTCACCGATTGGCAGCTGTG -3'
(R):5'- AGACATTAACTTGCTGTTTATTTTGG -3'
Posted On 2017-01-03