Incidental Mutation 'R5706:Tubgcp2'
ID451977
Institutional Source Beutler Lab
Gene Symbol Tubgcp2
Ensembl Gene ENSMUSG00000025474
Gene Nametubulin, gamma complex associated protein 2
Synonyms1700022B05Rik
MMRRC Submission 043331-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.939) question?
Stock #R5706 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location139995955-140036669 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 140032225 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 78 (E78*)
Ref Sequence ENSEMBL: ENSMUSP00000147766 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026547] [ENSMUST00000168194] [ENSMUST00000209574] [ENSMUST00000210224] [ENSMUST00000211261] [ENSMUST00000211638] [ENSMUST00000211789]
AlphaFold Q921G8
Predicted Effect probably benign
Transcript: ENSMUST00000026547
AA Change: R58L

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000026547
Gene: ENSMUSG00000025474
AA Change: R58L

DomainStartEndE-ValueType
low complexity region 109 121 N/A INTRINSIC
Pfam:Spc97_Spc98 220 738 8.6e-123 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168194
SMART Domains Protein: ENSMUSP00000129154
Gene: ENSMUSG00000025470

DomainStartEndE-ValueType
low complexity region 32 45 N/A INTRINSIC
ZnF_C2H2 80 105 4.23e0 SMART
ZnF_C2H2 107 130 1.36e1 SMART
ZnF_C2H2 144 169 3.52e-1 SMART
low complexity region 186 205 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000209574
AA Change: R58L

PolyPhen 2 Score 0.782 (Sensitivity: 0.85; Specificity: 0.93)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209930
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210089
Predicted Effect probably damaging
Transcript: ENSMUST00000210224
AA Change: R58L

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210419
Predicted Effect probably benign
Transcript: ENSMUST00000210882
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210936
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211186
Predicted Effect probably null
Transcript: ENSMUST00000211261
AA Change: E78*
Predicted Effect possibly damaging
Transcript: ENSMUST00000211638
AA Change: R58L

PolyPhen 2 Score 0.679 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect probably benign
Transcript: ENSMUST00000211789
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T A 3: 122,054,261 M77K probably benign Het
Amy1 A G 3: 113,556,120 V467A probably damaging Het
Atf4 T C 15: 80,256,330 V11A possibly damaging Het
B4galt1 T C 4: 40,807,268 N373D probably damaging Het
Bpifa3 A G 2: 154,135,578 K112R probably damaging Het
Chd2 T A 7: 73,491,357 Y596F possibly damaging Het
Clspn T C 4: 126,578,418 S962P probably damaging Het
Cyp2c68 T C 19: 39,734,318 D262G possibly damaging Het
Dcaf11 T C 14: 55,565,695 I282T probably damaging Het
Dmxl1 T C 18: 49,957,395 probably null Het
Dnah11 T G 12: 118,023,935 K2411Q probably damaging Het
Elf3 A G 1: 135,256,482 V196A probably benign Het
Fhad1 T G 4: 141,954,116 T538P probably damaging Het
Fkbp10 A G 11: 100,421,023 D174G probably damaging Het
Gas6 A G 8: 13,477,098 S217P probably damaging Het
Gm4778 T A 3: 94,266,652 H322Q possibly damaging Het
Heatr5b C T 17: 78,766,875 probably null Het
Iqgap3 A G 3: 88,115,908 E502G probably benign Het
Klc1 T C 12: 111,795,627 V577A possibly damaging Het
Lck T C 4: 129,551,638 probably null Het
Mc3r C A 2: 172,249,690 Y277* probably null Het
Mlxipl T C 5: 135,133,604 V640A probably benign Het
Mrc2 A T 11: 105,332,343 N471Y probably damaging Het
Ncan T A 8: 70,102,017 H1050L probably damaging Het
Nrl C A 14: 55,522,432 V13F probably damaging Het
Obscn T A 11: 59,076,256 Y546F probably damaging Het
Olfr214 A G 6: 116,557,113 I229M probably damaging Het
Olfr654 T G 7: 104,587,890 S46A probably benign Het
Olfr799 A G 10: 129,648,091 probably null Het
Pde3b G A 7: 114,521,692 G684D probably damaging Het
Prkaa1 C T 15: 5,174,342 T244I probably benign Het
Scfd2 A T 5: 74,206,398 probably null Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Smg1 A T 7: 118,145,590 V3113D possibly damaging Het
Sorbs1 T C 19: 40,376,881 T153A probably benign Het
Spag16 A G 1: 69,870,289 T182A probably benign Het
Svs2 T C 2: 164,237,669 K106R possibly damaging Het
Tenm1 A G X: 43,074,695 V107A possibly damaging Het
Topaz1 A T 9: 122,799,485 I1546F possibly damaging Het
Vars A G 17: 35,005,481 probably null Het
Vmn2r109 A T 17: 20,554,305 W263R probably benign Het
Other mutations in Tubgcp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Tubgcp2 APN 7 140031022 missense possibly damaging 0.58
IGL00791:Tubgcp2 APN 7 140001498 missense probably damaging 0.97
IGL02643:Tubgcp2 APN 7 139996154 missense probably damaging 1.00
IGL02710:Tubgcp2 APN 7 140004984 splice site probably benign
IGL03352:Tubgcp2 APN 7 140001027 missense probably benign 0.01
R0189:Tubgcp2 UTSW 7 140001605 splice site probably benign
R0333:Tubgcp2 UTSW 7 139999347 missense probably damaging 1.00
R0379:Tubgcp2 UTSW 7 140032192 missense probably damaging 1.00
R1051:Tubgcp2 UTSW 7 139998896 missense probably benign 0.26
R1192:Tubgcp2 UTSW 7 140029838 missense probably benign
R1528:Tubgcp2 UTSW 7 140033783 unclassified probably benign
R1728:Tubgcp2 UTSW 7 139998055 missense probably benign
R1729:Tubgcp2 UTSW 7 139998055 missense probably benign
R1784:Tubgcp2 UTSW 7 139998055 missense probably benign
R1888:Tubgcp2 UTSW 7 139999270 missense probably damaging 1.00
R1888:Tubgcp2 UTSW 7 140006156 missense probably damaging 1.00
R1888:Tubgcp2 UTSW 7 139999270 missense probably damaging 1.00
R1888:Tubgcp2 UTSW 7 140006156 missense probably damaging 1.00
R1967:Tubgcp2 UTSW 7 140006153 missense probably benign 0.09
R4514:Tubgcp2 UTSW 7 139996071 missense possibly damaging 0.51
R4545:Tubgcp2 UTSW 7 139996071 missense possibly damaging 0.51
R4774:Tubgcp2 UTSW 7 139996161 missense probably damaging 1.00
R4790:Tubgcp2 UTSW 7 139999288 missense probably damaging 1.00
R5114:Tubgcp2 UTSW 7 140007441 missense possibly damaging 0.91
R5435:Tubgcp2 UTSW 7 139996072 missense possibly damaging 0.51
R5531:Tubgcp2 UTSW 7 140005024 splice site probably null
R5699:Tubgcp2 UTSW 7 139998788 missense possibly damaging 0.53
R6123:Tubgcp2 UTSW 7 140007597 missense probably damaging 1.00
R7153:Tubgcp2 UTSW 7 140001036 missense probably benign
R7165:Tubgcp2 UTSW 7 140005361 missense probably damaging 0.99
R7213:Tubgcp2 UTSW 7 140008014 missense probably benign 0.28
R7424:Tubgcp2 UTSW 7 140007924 missense possibly damaging 0.65
R7511:Tubgcp2 UTSW 7 140004880 missense probably benign 0.00
R7523:Tubgcp2 UTSW 7 140006870 missense probably benign 0.08
R7612:Tubgcp2 UTSW 7 140001051 missense probably damaging 1.00
R7951:Tubgcp2 UTSW 7 140007980 missense possibly damaging 0.69
R8220:Tubgcp2 UTSW 7 140006140 missense possibly damaging 0.92
R8481:Tubgcp2 UTSW 7 140033675 missense probably damaging 1.00
R8717:Tubgcp2 UTSW 7 139996792 missense probably benign
R8886:Tubgcp2 UTSW 7 140004969 missense probably benign 0.04
X0004:Tubgcp2 UTSW 7 140007021 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- ATGCCTTATGTGCATTTACATCTGC -3'
(R):5'- CGCGGACCATAGACATTAACTTG -3'

Sequencing Primer
(F):5'- TCTCACCGATTGGCAGCTGTG -3'
(R):5'- AGACATTAACTTGCTGTTTATTTTGG -3'
Posted On2017-01-03