Mutagenetix > Incidental Mutation

Incidental Mutation 'R5706:Gas6'

451978

Institutional Source

Beutler Lab

Gene Symbol

Gas6

Ensembl Gene

ENSMUSG00000031451

Gene Name

growth arrest specific 6

Synonyms

growth arrest-specific, Gas-6, GAS 6

MMRRC Submission

043331-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5706 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

13465374-13494490 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 13477098 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 217 (S217P)

Ref Sequence

ENSEMBL: ENSMUSP00000033828 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033828]

AlphaFold

Q61592

Predicted Effect

probably damaging
Transcript: ENSMUST00000033828
AA Change: S217P

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000033828
Gene: ENSMUSG00000031451
AA Change: S217P

Domain	Start	End	E-Value	Type
low complexity region	2	21	N/A	INTRINSIC
GLA	26	90	6.66e-30	SMART
EGF	116	151	3.97e0	SMART
EGF_CA	153	193	3.1e-11	SMART
EGF_CA	194	234	1.91e-11	SMART
EGF_CA	235	275	1.25e-6	SMART
LamG	314	450	2.71e-24	SMART
LamG	502	647	1.27e-15	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a gamma-carboxyglutamic acid (Gla)-containing protein thought to be involved in the stimulation of cell proliferation. This gene is frequently overexpressed in many cancers and has been implicated as an adverse prognostic marker. Elevated protein levels are additionally associated with a variety of disease states, including venous thromboembolic disease, systemic lupus erythematosus, chronic renal failure, and preeclampsia. [provided by RefSeq, Aug 2014]
PHENOTYPE: Homozygous null mice are protected against arterial and venous thrombosis, and though platelet aggregation is impaired, spontaneous or excess trauma-induced bleeding is not observed. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca4	T	A	3: 122,054,261	M77K	probably benign	Het
Amy1	A	G	3: 113,556,120	V467A	probably damaging	Het
Atf4	T	C	15: 80,256,330	V11A	possibly damaging	Het
B4galt1	T	C	4: 40,807,268	N373D	probably damaging	Het
Bpifa3	A	G	2: 154,135,578	K112R	probably damaging	Het
Chd2	T	A	7: 73,491,357	Y596F	possibly damaging	Het
Clspn	T	C	4: 126,578,418	S962P	probably damaging	Het
Cyp2c68	T	C	19: 39,734,318	D262G	possibly damaging	Het
Dcaf11	T	C	14: 55,565,695	I282T	probably damaging	Het
Dmxl1	T	C	18: 49,957,395		probably null	Het
Dnah11	T	G	12: 118,023,935	K2411Q	probably damaging	Het
Elf3	A	G	1: 135,256,482	V196A	probably benign	Het
Fhad1	T	G	4: 141,954,116	T538P	probably damaging	Het
Fkbp10	A	G	11: 100,421,023	D174G	probably damaging	Het
Gm4778	T	A	3: 94,266,652	H322Q	possibly damaging	Het
Heatr5b	C	T	17: 78,766,875		probably null	Het
Iqgap3	A	G	3: 88,115,908	E502G	probably benign	Het
Klc1	T	C	12: 111,795,627	V577A	possibly damaging	Het
Lck	T	C	4: 129,551,638		probably null	Het
Mc3r	C	A	2: 172,249,690	Y277*	probably null	Het
Mlxipl	T	C	5: 135,133,604	V640A	probably benign	Het
Mrc2	A	T	11: 105,332,343	N471Y	probably damaging	Het
Ncan	T	A	8: 70,102,017	H1050L	probably damaging	Het
Nrl	C	A	14: 55,522,432	V13F	probably damaging	Het
Obscn	T	A	11: 59,076,256	Y546F	probably damaging	Het
Olfr214	A	G	6: 116,557,113	I229M	probably damaging	Het
Olfr654	T	G	7: 104,587,890	S46A	probably benign	Het
Olfr799	A	G	10: 129,648,091		probably null	Het
Pde3b	G	A	7: 114,521,692	G684D	probably damaging	Het
Prkaa1	C	T	15: 5,174,342	T244I	probably benign	Het
Scfd2	A	T	5: 74,206,398		probably null	Het
Slc22a30	G	A	19: 8,344,393	Q436*	probably null	Het
Smg1	A	T	7: 118,145,590	V3113D	possibly damaging	Het
Sorbs1	T	C	19: 40,376,881	T153A	probably benign	Het
Spag16	A	G	1: 69,870,289	T182A	probably benign	Het
Svs2	T	C	2: 164,237,669	K106R	possibly damaging	Het
Tenm1	A	G	X: 43,074,695	V107A	possibly damaging	Het
Topaz1	A	T	9: 122,799,485	I1546F	possibly damaging	Het
Tubgcp2	C	A	7: 140,032,225	E78*	probably null	Het
Vars	A	G	17: 35,005,481		probably null	Het
Vmn2r109	A	T	17: 20,554,305	W263R	probably benign	Het

Other mutations in Gas6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00988:Gas6	APN	8	13476171	missense	probably damaging	0.99
IGL01100:Gas6	APN	8	13475118	missense	probably benign	0.27
IGL02014:Gas6	APN	8	13468359	missense	possibly damaging	0.59
IGL02931:Gas6	APN	8	13477136	missense	probably damaging	0.98
R0023:Gas6	UTSW	8	13470344	missense	probably damaging	1.00
R0497:Gas6	UTSW	8	13470387	missense	possibly damaging	0.86
R1126:Gas6	UTSW	8	13483700	missense	probably benign	0.02
R1597:Gas6	UTSW	8	13493901	missense	probably damaging	1.00
R1601:Gas6	UTSW	8	13465786	missense	probably damaging	1.00
R1643:Gas6	UTSW	8	13465902	critical splice acceptor site	probably null
R1914:Gas6	UTSW	8	13477152	missense	probably benign
R1967:Gas6	UTSW	8	13470317	missense	probably damaging	0.98
R2012:Gas6	UTSW	8	13468266	missense	probably damaging	1.00
R4663:Gas6	UTSW	8	13470254	missense	probably damaging	1.00
R4723:Gas6	UTSW	8	13466848	missense	probably damaging	0.99
R4750:Gas6	UTSW	8	13476227	missense	probably benign	0.29
R4869:Gas6	UTSW	8	13475086	missense	possibly damaging	0.55
R5558:Gas6	UTSW	8	13466764	missense	probably null	0.03
R5791:Gas6	UTSW	8	13470217	critical splice donor site	probably null
R6767:Gas6	UTSW	8	13465784	missense	probably damaging	0.98
R6825:Gas6	UTSW	8	13483674	missense	probably benign	0.00
R7374:Gas6	UTSW	8	13474802	missense	probably damaging	0.99
R7419:Gas6	UTSW	8	13471456	missense	probably benign	0.19
R7588:Gas6	UTSW	8	13466711	missense	probably benign	0.03
R7810:Gas6	UTSW	8	13466809	missense	probably damaging	1.00
R8222:Gas6	UTSW	8	13470276	missense	probably benign	0.00
R8527:Gas6	UTSW	8	13465790	missense	probably damaging	1.00
R8705:Gas6	UTSW	8	13475156	missense	probably damaging	1.00
R8987:Gas6	UTSW	8	13470294	missense	probably damaging	1.00
R9553:Gas6	UTSW	8	13475048	missense	possibly damaging	0.84
R9672:Gas6	UTSW	8	13478273	missense	probably benign	0.00
X0063:Gas6	UTSW	8	13471538	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGACTTCCTGGAACACTGGAC -3'
(R):5'- CAATGTGGATGAGCAGCATGTG -3'

Sequencing Primer
(F):5'- CCTGGAACACTGGACCAATGATTG -3'
(R):5'- ACTATCACTTGACACCCGTGG -3'

Posted On

2017-01-03