Incidental Mutation 'R0551:Cpox'
ID 45198
Institutional Source Beutler Lab
Gene Symbol Cpox
Ensembl Gene ENSMUSG00000022742
Gene Name coproporphyrinogen oxidase
Synonyms nct, Cpo, cac, clone 560
MMRRC Submission 038743-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0551 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 58670292-58717636 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 58675390 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 357 (I357V)
Ref Sequence ENSEMBL: ENSMUSP00000055455 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060077]
AlphaFold P36552
Predicted Effect probably benign
Transcript: ENSMUST00000060077
AA Change: I357V

PolyPhen 2 Score 0.110 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000055455
Gene: ENSMUSG00000022742
AA Change: I357V

DomainStartEndE-ValueType
low complexity region 57 81 N/A INTRINSIC
low complexity region 94 105 N/A INTRINSIC
Pfam:Coprogen_oxidas 140 442 7.6e-142 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231276
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231492
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232176
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232532
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the sixth enzyme of the heme biosynthetic pathway. The encoded enzyme is soluble and found in the intermembrane space of mitochondria. This enzyme catalyzes the stepwise oxidative decarboxylation of coproporphyrinogen III to protoporphyrinogen IX, a precursor of heme. Defects in this gene are a cause of hereditary coproporphyria (HCP).[provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a spontaneous allele develop cataracts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T A 14: 32,662,641 T456S probably benign Het
5830473C10Rik C T 5: 90,572,719 P250S probably damaging Het
Acmsd A T 1: 127,766,333 K333N probably benign Het
Adcy2 T A 13: 68,796,539 K241N probably damaging Het
Aebp1 A G 11: 5,867,955 I77V probably benign Het
Ankrd35 A G 3: 96,683,960 T521A probably benign Het
Arap2 C T 5: 62,641,323 probably null Het
Arfgap3 A T 15: 83,343,137 C25S probably damaging Het
Arhgap20 T A 9: 51,825,825 probably benign Het
Arhgap39 C T 15: 76,734,886 D833N probably damaging Het
Auts2 T C 5: 131,440,469 E446G possibly damaging Het
Brwd1 C T 16: 96,035,974 R886H probably damaging Het
Carm1 G A 9: 21,580,491 probably null Het
Cdc5l G A 17: 45,415,684 R321W probably damaging Het
Cfap54 A T 10: 93,025,122 M841K probably benign Het
Clca4b T A 3: 144,928,626 T69S probably damaging Het
Diaph3 C A 14: 86,910,100 V711L probably benign Het
Fabp3-ps1 T C 10: 86,732,040 probably benign Het
Fam120b A T 17: 15,431,643 probably benign Het
Fcho1 A G 8: 71,712,174 S488P probably benign Het
Flcn A G 11: 59,795,748 probably null Het
Flt3l A G 7: 45,132,266 W234R probably damaging Het
Fzd7 G T 1: 59,483,284 V109L probably damaging Het
G3bp1 A G 11: 55,489,143 N101S probably benign Het
Gadd45g A G 13: 51,847,927 E143G probably damaging Het
Ganab T G 19: 8,907,280 I149S probably benign Het
Garnl3 A G 2: 33,016,738 S413P probably damaging Het
Glis1 C T 4: 107,568,119 probably null Het
Gm11563 A G 11: 99,658,713 S72P unknown Het
Gpd1 T G 15: 99,720,629 I188S possibly damaging Het
Gria2 A G 3: 80,732,026 probably benign Het
H2afy2 A G 10: 61,741,166 S308P probably damaging Het
Hpcal4 G T 4: 123,189,055 A65S possibly damaging Het
Igsf10 G A 3: 59,328,668 T1364I probably benign Het
Kdm4a T C 4: 118,138,231 *1065W probably null Het
Klkb1 A G 8: 45,277,966 probably null Het
Lipo3 T C 19: 33,580,551 D147G probably damaging Het
Lrp1 A G 10: 127,571,958 S1821P probably benign Het
Manba T C 3: 135,517,973 I207T probably damaging Het
Mark3 T A 12: 111,633,634 S428T probably benign Het
Mfsd4a G A 1: 132,041,919 T348I probably damaging Het
Mfsd7a A G 5: 108,444,465 probably benign Het
Mybbp1a A G 11: 72,448,376 M880V probably benign Het
N4bp2 T A 5: 65,820,341 probably null Het
Nrd1 T G 4: 109,047,708 I712S probably damaging Het
Nup210 G A 6: 91,021,484 R774C possibly damaging Het
Obscn G A 11: 59,107,862 R1395* probably null Het
Olfr1454 T A 19: 13,064,294 D294E probably benign Het
Pcdh7 T C 5: 57,721,994 Y964H probably damaging Het
Plin4 T C 17: 56,106,756 T290A probably benign Het
Ppara T C 15: 85,787,105 probably benign Het
Psg21 T G 7: 18,652,640 probably null Het
Ptar1 C A 19: 23,720,340 N405K probably benign Het
Ralgps2 A G 1: 156,832,663 probably null Het
Rnf6 T A 5: 146,211,395 N271I possibly damaging Het
Sis T C 3: 72,925,407 D1019G possibly damaging Het
Slc37a3 A G 6: 39,352,754 probably benign Het
Slc6a12 G A 6: 121,356,918 V238I probably damaging Het
Sntg1 C A 1: 8,554,736 V279L possibly damaging Het
Sorbs1 T A 19: 40,311,816 E567D probably damaging Het
Sp110 C A 1: 85,589,100 probably benign Het
Ssu2 A G 6: 112,380,554 V175A possibly damaging Het
Stk36 G A 1: 74,616,621 E428K probably benign Het
Teddm1b A T 1: 153,875,344 I300F possibly damaging Het
Thy1 T C 9: 44,047,348 V129A probably damaging Het
Tiam2 T A 17: 3,428,954 M654K probably damaging Het
Tmem69 T C 4: 116,553,273 S167G probably benign Het
Tmem8 C A 17: 26,120,602 Q605K probably damaging Het
Tmem81 C G 1: 132,507,829 I124M probably damaging Het
Tspan10 A G 11: 120,444,418 D118G probably damaging Het
Tspo2 A G 17: 48,448,813 probably benign Het
Ttn G A 2: 76,908,328 Q4002* probably null Het
Tyro3 G A 2: 119,816,904 R834Q probably damaging Het
Ugt2b1 T C 5: 86,926,084 K139E probably benign Het
Vmn1r9 A T 6: 57,071,539 I200F probably benign Het
Other mutations in Cpox
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02152:Cpox APN 16 58674424 missense possibly damaging 0.87
IGL03031:Cpox APN 16 58672560 missense probably damaging 1.00
IGL03034:Cpox APN 16 58675355 missense probably damaging 0.98
scraggy UTSW 16 58670935 missense probably damaging 1.00
R0413:Cpox UTSW 16 58670869 missense possibly damaging 0.52
R0523:Cpox UTSW 16 58675245 nonsense probably null
R2064:Cpox UTSW 16 58674409 missense probably benign 0.36
R4651:Cpox UTSW 16 58670687 missense possibly damaging 0.92
R4701:Cpox UTSW 16 58677969 nonsense probably null
R4782:Cpox UTSW 16 58672623 missense probably damaging 1.00
R5285:Cpox UTSW 16 58675286 missense probably damaging 1.00
R5287:Cpox UTSW 16 58675286 missense probably damaging 1.00
R5313:Cpox UTSW 16 58677948 nonsense probably null
R5346:Cpox UTSW 16 58675286 missense probably damaging 1.00
R5354:Cpox UTSW 16 58670842 missense probably damaging 0.99
R5404:Cpox UTSW 16 58675286 missense probably damaging 1.00
R5476:Cpox UTSW 16 58678725 missense probably damaging 0.99
R5853:Cpox UTSW 16 58675417 missense probably damaging 0.99
R6026:Cpox UTSW 16 58670935 missense probably damaging 1.00
R7059:Cpox UTSW 16 58670927 missense probably damaging 1.00
R7061:Cpox UTSW 16 58670860 missense possibly damaging 0.76
R7606:Cpox UTSW 16 58674449 missense probably benign 0.16
R8753:Cpox UTSW 16 58678028 missense probably damaging 1.00
R8779:Cpox UTSW 16 58670866 missense probably damaging 1.00
R8793:Cpox UTSW 16 58673345 missense probably damaging 1.00
R9667:Cpox UTSW 16 58670621 missense possibly damaging 0.52
R9736:Cpox UTSW 16 58674383 missense probably benign 0.00
RF059:Cpox UTSW 16 58670767 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CGTTTCAAGTCGCACGCATCTC -3'
(R):5'- AGTTCTTACCACGTAAATGCCTACCAC -3'

Sequencing Primer
(F):5'- AGTCGCACGCATCTCTCATC -3'
(R):5'- agccatctcaccagccc -3'
Posted On 2013-06-11