Incidental Mutation 'R5706:Olfr799'
ID451983
Institutional Source Beutler Lab
Gene Symbol Olfr799
Ensembl Gene ENSMUSG00000094734
Gene Nameolfactory receptor 799
SynonymsMOR114-2, GA_x6K02T2PULF-11325750-11326685
MMRRC Submission 043331-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R5706 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location129637484-129648326 bp(+) (GRCm38)
Type of Mutationunclassified (26 bp from exon)
DNA Base Change (assembly) A to G at 129648091 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000071126 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071126] [ENSMUST00000213820] [ENSMUST00000214182] [ENSMUST00000216446] [ENSMUST00000217364]
Predicted Effect probably null
Transcript: ENSMUST00000071126
SMART Domains Protein: ENSMUSP00000071126
Gene: ENSMUSG00000094734

DomainStartEndE-ValueType
Pfam:7tm_4 28 305 6e-46 PFAM
Pfam:7TM_GPCR_Srsx 32 302 6e-7 PFAM
Pfam:7tm_1 38 287 7.7e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213820
Predicted Effect probably benign
Transcript: ENSMUST00000214182
Predicted Effect probably benign
Transcript: ENSMUST00000216446
Predicted Effect probably benign
Transcript: ENSMUST00000217364
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T A 3: 122,054,261 M77K probably benign Het
Amy1 A G 3: 113,556,120 V467A probably damaging Het
Atf4 T C 15: 80,256,330 V11A possibly damaging Het
B4galt1 T C 4: 40,807,268 N373D probably damaging Het
Bpifa3 A G 2: 154,135,578 K112R probably damaging Het
Chd2 T A 7: 73,491,357 Y596F possibly damaging Het
Clspn T C 4: 126,578,418 S962P probably damaging Het
Cyp2c68 T C 19: 39,734,318 D262G possibly damaging Het
Dcaf11 T C 14: 55,565,695 I282T probably damaging Het
Dmxl1 T C 18: 49,957,395 probably null Het
Dnah11 T G 12: 118,023,935 K2411Q probably damaging Het
Elf3 A G 1: 135,256,482 V196A probably benign Het
Fhad1 T G 4: 141,954,116 T538P probably damaging Het
Fkbp10 A G 11: 100,421,023 D174G probably damaging Het
Gas6 A G 8: 13,477,098 S217P probably damaging Het
Gm4778 T A 3: 94,266,652 H322Q possibly damaging Het
Heatr5b C T 17: 78,766,875 probably null Het
Iqgap3 A G 3: 88,115,908 E502G probably benign Het
Klc1 T C 12: 111,795,627 V577A possibly damaging Het
Lck T C 4: 129,551,638 probably null Het
Mc3r C A 2: 172,249,690 Y277* probably null Het
Mlxipl T C 5: 135,133,604 V640A probably benign Het
Mrc2 A T 11: 105,332,343 N471Y probably damaging Het
Ncan T A 8: 70,102,017 H1050L probably damaging Het
Nrl C A 14: 55,522,432 V13F probably damaging Het
Obscn T A 11: 59,076,256 Y546F probably damaging Het
Olfr214 A G 6: 116,557,113 I229M probably damaging Het
Olfr654 T G 7: 104,587,890 S46A probably benign Het
Pde3b G A 7: 114,521,692 G684D probably damaging Het
Prkaa1 C T 15: 5,174,342 T244I probably benign Het
Scfd2 A T 5: 74,206,398 probably null Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Smg1 A T 7: 118,145,590 V3113D possibly damaging Het
Sorbs1 T C 19: 40,376,881 T153A probably benign Het
Spag16 A G 1: 69,870,289 T182A probably benign Het
Svs2 T C 2: 164,237,669 K106R possibly damaging Het
Tenm1 A G X: 43,074,695 V107A possibly damaging Het
Topaz1 A T 9: 122,799,485 I1546F possibly damaging Het
Tubgcp2 C A 7: 140,032,225 E78* probably null Het
Vars A G 17: 35,005,481 probably null Het
Vmn2r109 A T 17: 20,554,305 W263R probably benign Het
Other mutations in Olfr799
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Olfr799 APN 10 129647437 missense probably benign 0.09
IGL01079:Olfr799 APN 10 129647374 missense possibly damaging 0.79
IGL01095:Olfr799 APN 10 129647629 missense probably benign 0.00
R0080:Olfr799 UTSW 10 129647653 missense probably benign 0.00
R0082:Olfr799 UTSW 10 129647653 missense probably benign 0.00
R0268:Olfr799 UTSW 10 129647176 missense possibly damaging 0.94
R0310:Olfr799 UTSW 10 129647731 missense probably damaging 1.00
R0315:Olfr799 UTSW 10 129647497 missense probably damaging 1.00
R0545:Olfr799 UTSW 10 129647349 missense probably damaging 1.00
R1257:Olfr799 UTSW 10 129647544 nonsense probably null
R2355:Olfr799 UTSW 10 129647842 missense probably benign 0.02
R4905:Olfr799 UTSW 10 129647923 missense possibly damaging 0.88
R5961:Olfr799 UTSW 10 129647854 missense possibly damaging 0.58
R6233:Olfr799 UTSW 10 129647296 missense probably benign 0.01
R6843:Olfr799 UTSW 10 129647179 missense possibly damaging 0.86
R7426:Olfr799 UTSW 10 129647158 missense probably damaging 1.00
R7507:Olfr799 UTSW 10 129647497 missense probably damaging 1.00
R7871:Olfr799 UTSW 10 129647412 missense probably benign
R8315:Olfr799 UTSW 10 129647653 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGTAGCTGCATCTTCATTTATGTC -3'
(R):5'- AGTCAGACAACAATTTCAGGTTGAC -3'

Sequencing Primer
(F):5'- AGCTGCATCTTCATTTATGTCAAACC -3'
(R):5'- CAGGTTGACTGCAAGACTAAAC -3'
Posted On2017-01-03