Incidental Mutation 'R5706:Olfr799'
ID 451983
Institutional Source Beutler Lab
Gene Symbol Olfr799
Ensembl Gene ENSMUSG00000094734
Gene Name olfactory receptor 799
Synonyms MOR114-2, GA_x6K02T2PULF-11325750-11326685
MMRRC Submission 043331-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.058) question?
Stock # R5706 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 129637484-129648326 bp(+) (GRCm38)
Type of Mutation splice site (26 bp from exon)
DNA Base Change (assembly) A to G at 129648091 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000071126 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071126] [ENSMUST00000213820] [ENSMUST00000214182] [ENSMUST00000216446] [ENSMUST00000217364]
AlphaFold Q8VGI7
Predicted Effect probably null
Transcript: ENSMUST00000071126
SMART Domains Protein: ENSMUSP00000071126
Gene: ENSMUSG00000094734

DomainStartEndE-ValueType
Pfam:7tm_4 28 305 6e-46 PFAM
Pfam:7TM_GPCR_Srsx 32 302 6e-7 PFAM
Pfam:7tm_1 38 287 7.7e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213820
Predicted Effect probably benign
Transcript: ENSMUST00000214182
Predicted Effect probably benign
Transcript: ENSMUST00000216446
Predicted Effect probably benign
Transcript: ENSMUST00000217364
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T A 3: 122,054,261 (GRCm38) M77K probably benign Het
Amy1 A G 3: 113,556,120 (GRCm38) V467A probably damaging Het
Atf4 T C 15: 80,256,330 (GRCm38) V11A possibly damaging Het
B4galt1 T C 4: 40,807,268 (GRCm38) N373D probably damaging Het
Bpifa3 A G 2: 154,135,578 (GRCm38) K112R probably damaging Het
Chd2 T A 7: 73,491,357 (GRCm38) Y596F possibly damaging Het
Clspn T C 4: 126,578,418 (GRCm38) S962P probably damaging Het
Cyp2c68 T C 19: 39,734,318 (GRCm38) D262G possibly damaging Het
Dcaf11 T C 14: 55,565,695 (GRCm38) I282T probably damaging Het
Dmxl1 T C 18: 49,957,395 (GRCm38) probably null Het
Dnah11 T G 12: 118,023,935 (GRCm38) K2411Q probably damaging Het
Elf3 A G 1: 135,256,482 (GRCm38) V196A probably benign Het
Fhad1 T G 4: 141,954,116 (GRCm38) T538P probably damaging Het
Fkbp10 A G 11: 100,421,023 (GRCm38) D174G probably damaging Het
Gas6 A G 8: 13,477,098 (GRCm38) S217P probably damaging Het
Gm4778 T A 3: 94,266,652 (GRCm38) H322Q possibly damaging Het
Heatr5b C T 17: 78,766,875 (GRCm38) probably null Het
Iqgap3 A G 3: 88,115,908 (GRCm38) E502G probably benign Het
Klc1 T C 12: 111,795,627 (GRCm38) V577A possibly damaging Het
Lck T C 4: 129,551,638 (GRCm38) probably null Het
Mc3r C A 2: 172,249,690 (GRCm38) Y277* probably null Het
Mlxipl T C 5: 135,133,604 (GRCm38) V640A probably benign Het
Mrc2 A T 11: 105,332,343 (GRCm38) N471Y probably damaging Het
Ncan T A 8: 70,102,017 (GRCm38) H1050L probably damaging Het
Nrl C A 14: 55,522,432 (GRCm38) V13F probably damaging Het
Obscn T A 11: 59,076,256 (GRCm38) Y546F probably damaging Het
Olfr214 A G 6: 116,557,113 (GRCm38) I229M probably damaging Het
Olfr654 T G 7: 104,587,890 (GRCm38) S46A probably benign Het
Pde3b G A 7: 114,521,692 (GRCm38) G684D probably damaging Het
Prkaa1 C T 15: 5,174,342 (GRCm38) T244I probably benign Het
Scfd2 A T 5: 74,206,398 (GRCm38) probably null Het
Slc22a30 G A 19: 8,344,393 (GRCm38) Q436* probably null Het
Smg1 A T 7: 118,145,590 (GRCm38) V3113D possibly damaging Het
Sorbs1 T C 19: 40,376,881 (GRCm38) T153A probably benign Het
Spag16 A G 1: 69,870,289 (GRCm38) T182A probably benign Het
Svs2 T C 2: 164,237,669 (GRCm38) K106R possibly damaging Het
Tenm1 A G X: 43,074,695 (GRCm38) V107A possibly damaging Het
Topaz1 A T 9: 122,799,485 (GRCm38) I1546F possibly damaging Het
Tubgcp2 C A 7: 140,032,225 (GRCm38) E78* probably null Het
Vars A G 17: 35,005,481 (GRCm38) probably null Het
Vmn2r109 A T 17: 20,554,305 (GRCm38) W263R probably benign Het
Other mutations in Olfr799
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Olfr799 APN 10 129,647,437 (GRCm38) missense probably benign 0.09
IGL01079:Olfr799 APN 10 129,647,374 (GRCm38) missense possibly damaging 0.79
IGL01095:Olfr799 APN 10 129,647,629 (GRCm38) missense probably benign 0.00
R0080:Olfr799 UTSW 10 129,647,653 (GRCm38) missense probably benign 0.00
R0082:Olfr799 UTSW 10 129,647,653 (GRCm38) missense probably benign 0.00
R0268:Olfr799 UTSW 10 129,647,176 (GRCm38) missense possibly damaging 0.94
R0310:Olfr799 UTSW 10 129,647,731 (GRCm38) missense probably damaging 1.00
R0315:Olfr799 UTSW 10 129,647,497 (GRCm38) missense probably damaging 1.00
R0545:Olfr799 UTSW 10 129,647,349 (GRCm38) missense probably damaging 1.00
R1257:Olfr799 UTSW 10 129,647,544 (GRCm38) nonsense probably null
R2355:Olfr799 UTSW 10 129,647,842 (GRCm38) missense probably benign 0.02
R4905:Olfr799 UTSW 10 129,647,923 (GRCm38) missense possibly damaging 0.88
R5961:Olfr799 UTSW 10 129,647,854 (GRCm38) missense possibly damaging 0.58
R6233:Olfr799 UTSW 10 129,647,296 (GRCm38) missense probably benign 0.01
R6843:Olfr799 UTSW 10 129,647,179 (GRCm38) missense possibly damaging 0.86
R7426:Olfr799 UTSW 10 129,647,158 (GRCm38) missense probably damaging 1.00
R7507:Olfr799 UTSW 10 129,647,497 (GRCm38) missense probably damaging 1.00
R7871:Olfr799 UTSW 10 129,647,412 (GRCm38) missense probably benign
R8315:Olfr799 UTSW 10 129,647,653 (GRCm38) missense probably benign 0.00
R9153:Olfr799 UTSW 10 129,647,437 (GRCm38) missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- TGGTAGCTGCATCTTCATTTATGTC -3'
(R):5'- AGTCAGACAACAATTTCAGGTTGAC -3'

Sequencing Primer
(F):5'- AGCTGCATCTTCATTTATGTCAAACC -3'
(R):5'- CAGGTTGACTGCAAGACTAAAC -3'
Posted On 2017-01-03