Incidental Mutation 'R5706:Fkbp10'
ID451985
Institutional Source Beutler Lab
Gene Symbol Fkbp10
Ensembl Gene ENSMUSG00000001555
Gene NameFK506 binding protein 10
SynonymsFkbp6, Fkbp-rs1, Fkbp1-rs, FKBP65, 65kDa
MMRRC Submission 043331-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5706 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location100415697-100424824 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 100421023 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 174 (D174G)
Ref Sequence ENSEMBL: ENSMUSP00000001595 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001595] [ENSMUST00000107398] [ENSMUST00000107399] [ENSMUST00000107400]
Predicted Effect probably damaging
Transcript: ENSMUST00000001595
AA Change: D174G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000001595
Gene: ENSMUSG00000001555
AA Change: D174G

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Pfam:FKBP_C 54 146 5.4e-30 PFAM
Pfam:FKBP_C 166 258 4e-29 PFAM
Pfam:FKBP_C 278 370 2.3e-28 PFAM
Pfam:FKBP_C 391 482 6.2e-26 PFAM
EFh 503 528 2.16e0 SMART
EFh 545 573 2.04e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107398
SMART Domains Protein: ENSMUSP00000103021
Gene: ENSMUSG00000017176

DomainStartEndE-ValueType
Pfam:UMPH-1 44 261 3.5e-108 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107399
SMART Domains Protein: ENSMUSP00000103022
Gene: ENSMUSG00000017176

DomainStartEndE-ValueType
Pfam:UMPH-1 44 261 3.5e-108 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107400
AA Change: D174G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103023
Gene: ENSMUSG00000001555
AA Change: D174G

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Pfam:FKBP_C 54 146 1.4e-29 PFAM
Pfam:FKBP_C 166 258 2e-29 PFAM
Pfam:FKBP_C 279 370 4.9e-26 PFAM
EFh 391 416 2.16e0 SMART
EFh 433 461 2.04e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125616
Predicted Effect probably benign
Transcript: ENSMUST00000134815
SMART Domains Protein: ENSMUSP00000123577
Gene: ENSMUSG00000001555

DomainStartEndE-ValueType
Pfam:FKBP_C 34 65 1.6e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139084
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the FKBP-type peptidyl-prolyl cis/trans isomerase (PPIase) family. This protein localizes to the endoplasmic reticulum and acts as a molecular chaperone. Alternatively spliced variants encoding different isoforms have been reported, but their biological validity has not been determined.[provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygous null mice do not survive birth, and embryos exhibit delayed growth, tissue fragility, decreased aorta wall thickness, craniofacial and forelimb anomalies, and connective tissue alterations. Mutant MEFs retain procollagen in the cell layer and show dilated endoplasmic reticulum. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T A 3: 122,054,261 M77K probably benign Het
Amy1 A G 3: 113,556,120 V467A probably damaging Het
Atf4 T C 15: 80,256,330 V11A possibly damaging Het
B4galt1 T C 4: 40,807,268 N373D probably damaging Het
Bpifa3 A G 2: 154,135,578 K112R probably damaging Het
Chd2 T A 7: 73,491,357 Y596F possibly damaging Het
Clspn T C 4: 126,578,418 S962P probably damaging Het
Cyp2c68 T C 19: 39,734,318 D262G possibly damaging Het
Dcaf11 T C 14: 55,565,695 I282T probably damaging Het
Dmxl1 T C 18: 49,957,395 probably null Het
Dnah11 T G 12: 118,023,935 K2411Q probably damaging Het
Elf3 A G 1: 135,256,482 V196A probably benign Het
Fhad1 T G 4: 141,954,116 T538P probably damaging Het
Gas6 A G 8: 13,477,098 S217P probably damaging Het
Gm4778 T A 3: 94,266,652 H322Q possibly damaging Het
Heatr5b C T 17: 78,766,875 probably null Het
Iqgap3 A G 3: 88,115,908 E502G probably benign Het
Klc1 T C 12: 111,795,627 V577A possibly damaging Het
Lck T C 4: 129,551,638 probably null Het
Mc3r C A 2: 172,249,690 Y277* probably null Het
Mlxipl T C 5: 135,133,604 V640A probably benign Het
Mrc2 A T 11: 105,332,343 N471Y probably damaging Het
Ncan T A 8: 70,102,017 H1050L probably damaging Het
Nrl C A 14: 55,522,432 V13F probably damaging Het
Obscn T A 11: 59,076,256 Y546F probably damaging Het
Olfr214 A G 6: 116,557,113 I229M probably damaging Het
Olfr654 T G 7: 104,587,890 S46A probably benign Het
Olfr799 A G 10: 129,648,091 probably null Het
Pde3b G A 7: 114,521,692 G684D probably damaging Het
Prkaa1 C T 15: 5,174,342 T244I probably benign Het
Scfd2 A T 5: 74,206,398 probably null Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Smg1 A T 7: 118,145,590 V3113D possibly damaging Het
Sorbs1 T C 19: 40,376,881 T153A probably benign Het
Spag16 A G 1: 69,870,289 T182A probably benign Het
Svs2 T C 2: 164,237,669 K106R possibly damaging Het
Tenm1 A G X: 43,074,695 V107A possibly damaging Het
Topaz1 A T 9: 122,799,485 I1546F possibly damaging Het
Tubgcp2 C A 7: 140,032,225 E78* probably null Het
Vars A G 17: 35,005,481 probably null Het
Vmn2r109 A T 17: 20,554,305 W263R probably benign Het
Other mutations in Fkbp10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00962:Fkbp10 APN 11 100421817 missense probably benign 0.00
IGL02390:Fkbp10 APN 11 100416017 missense probably damaging 1.00
IGL02424:Fkbp10 APN 11 100415956 missense probably damaging 1.00
IGL02728:Fkbp10 APN 11 100415977 missense probably damaging 1.00
IGL02737:Fkbp10 APN 11 100422655 missense probably benign 0.25
IGL03143:Fkbp10 APN 11 100422754 missense probably benign 0.06
R0479:Fkbp10 UTSW 11 100415914 missense probably damaging 1.00
R1733:Fkbp10 UTSW 11 100423931 missense probably benign 0.20
R1817:Fkbp10 UTSW 11 100415889 missense probably benign 0.13
R1819:Fkbp10 UTSW 11 100415889 missense probably benign 0.13
R1831:Fkbp10 UTSW 11 100423219 missense probably damaging 1.00
R1997:Fkbp10 UTSW 11 100416015 missense probably damaging 1.00
R2017:Fkbp10 UTSW 11 100421673 missense possibly damaging 0.77
R3758:Fkbp10 UTSW 11 100422625 critical splice acceptor site probably null
R5163:Fkbp10 UTSW 11 100423099 missense probably benign 0.03
R5437:Fkbp10 UTSW 11 100421023 missense probably damaging 1.00
R5666:Fkbp10 UTSW 11 100423526 missense probably damaging 1.00
R5696:Fkbp10 UTSW 11 100423526 missense probably damaging 1.00
R5698:Fkbp10 UTSW 11 100423526 missense probably damaging 1.00
R7084:Fkbp10 UTSW 11 100421303 missense possibly damaging 0.56
R7405:Fkbp10 UTSW 11 100415881 missense probably damaging 1.00
R7780:Fkbp10 UTSW 11 100421222 missense probably damaging 1.00
R8237:Fkbp10 UTSW 11 100415959 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTTGTGTAAACCCCACCTC -3'
(R):5'- CATGCCTTTGATCAGCCAAC -3'

Sequencing Primer
(F):5'- GTGTAAACCCCACCTCTGCTG -3'
(R):5'- ATGTAGGTGTCATAAGTGCCTCCC -3'
Posted On2017-01-03