Incidental Mutation 'R5706:Klc1'
ID451988
Institutional Source Beutler Lab
Gene Symbol Klc1
Ensembl Gene ENSMUSG00000021288
Gene Namekinesin light chain 1
SynonymsKns2
MMRRC Submission 043331-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.423) question?
Stock #R5706 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location111758849-111807844 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 111795627 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 577 (V577A)
Ref Sequence ENSEMBL: ENSMUSP00000082004 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084941] [ENSMUST00000118471] [ENSMUST00000120544] [ENSMUST00000122300] [ENSMUST00000134578]
Predicted Effect possibly damaging
Transcript: ENSMUST00000084941
AA Change: V577A

PolyPhen 2 Score 0.647 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000082004
Gene: ENSMUSG00000021288
AA Change: V577A

DomainStartEndE-ValueType
coiled coil region 86 156 N/A INTRINSIC
low complexity region 158 179 N/A INTRINSIC
low complexity region 188 206 N/A INTRINSIC
Pfam:TPR_10 212 253 3.1e-9 PFAM
TPR 255 288 3.81e-1 SMART
TPR 297 330 1.16e-5 SMART
TPR 339 372 4.77e-2 SMART
TPR 381 414 2.78e-3 SMART
TPR 464 497 4.93e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118471
SMART Domains Protein: ENSMUSP00000113171
Gene: ENSMUSG00000021288

DomainStartEndE-ValueType
Pfam:Rab5-bind 80 254 8.3e-69 PFAM
Pfam:TPR_10 212 253 7.2e-9 PFAM
TPR 255 288 3.81e-1 SMART
TPR 297 330 1.16e-5 SMART
TPR 339 372 4.77e-2 SMART
TPR 381 414 2.78e-3 SMART
TPR 464 497 4.93e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120544
SMART Domains Protein: ENSMUSP00000113237
Gene: ENSMUSG00000021288

DomainStartEndE-ValueType
coiled coil region 86 156 N/A INTRINSIC
low complexity region 158 179 N/A INTRINSIC
low complexity region 188 206 N/A INTRINSIC
Pfam:TPR_10 212 253 3.2e-9 PFAM
TPR 255 288 3.81e-1 SMART
TPR 297 330 1.16e-5 SMART
TPR 339 372 4.77e-2 SMART
TPR 381 414 2.78e-3 SMART
TPR 464 497 4.93e1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000122300
AA Change: V569A

PolyPhen 2 Score 0.540 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000113997
Gene: ENSMUSG00000021288
AA Change: V569A

DomainStartEndE-ValueType
Pfam:Rab5-bind 80 254 1e-68 PFAM
Pfam:TPR_10 212 253 8.4e-9 PFAM
TPR 255 288 3.81e-1 SMART
TPR 297 330 1.16e-5 SMART
TPR 339 372 4.77e-2 SMART
TPR 381 414 2.78e-3 SMART
TPR 464 497 2.99e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124197
Predicted Effect probably benign
Transcript: ENSMUST00000134578
SMART Domains Protein: ENSMUSP00000120491
Gene: ENSMUSG00000021288

DomainStartEndE-ValueType
Pfam:TPR_1 1 25 1.9e-4 PFAM
Pfam:TPR_7 1 36 1.9e-4 PFAM
Pfam:TPR_10 75 112 7.8e-9 PFAM
Pfam:TPR_1 77 98 1.4e-4 PFAM
Pfam:TPR_7 78 129 1.7e-5 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141435
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: Conventional kinesin is a tetrameric molecule composed of two heavy chains and two light chains, and transports various cargos along microtubules toward their plus ends. The heavy chains provide the motor activity, while the light chains bind to various cargos. This gene encodes a member of the kinesin light chain family. It associates with kinesin heavy chain through an N-terminal domain, and six tetratricopeptide repeat (TPR) motifs are thought to be involved in binding of cargos such as vesicles, mitochondria, and the Golgi complex. Thus, kinesin light chains function as adapter molecules and not motors per se. Although previously named "kinesin 2", this gene is not a member of the kinesin-2 / kinesin heavy chain subfamily of kinesin motor proteins. Extensive alternative splicing produces isoforms with different C-termini that are proposed to bind to different cargos; however, the full-length nature of some of these variants has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene are significantly smaller than normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T A 3: 122,054,261 M77K probably benign Het
Amy1 A G 3: 113,556,120 V467A probably damaging Het
Atf4 T C 15: 80,256,330 V11A possibly damaging Het
B4galt1 T C 4: 40,807,268 N373D probably damaging Het
Bpifa3 A G 2: 154,135,578 K112R probably damaging Het
Chd2 T A 7: 73,491,357 Y596F possibly damaging Het
Clspn T C 4: 126,578,418 S962P probably damaging Het
Cyp2c68 T C 19: 39,734,318 D262G possibly damaging Het
Dcaf11 T C 14: 55,565,695 I282T probably damaging Het
Dmxl1 T C 18: 49,957,395 probably null Het
Dnah11 T G 12: 118,023,935 K2411Q probably damaging Het
Elf3 A G 1: 135,256,482 V196A probably benign Het
Fhad1 T G 4: 141,954,116 T538P probably damaging Het
Fkbp10 A G 11: 100,421,023 D174G probably damaging Het
Gas6 A G 8: 13,477,098 S217P probably damaging Het
Gm4778 T A 3: 94,266,652 H322Q possibly damaging Het
Heatr5b C T 17: 78,766,875 probably null Het
Iqgap3 A G 3: 88,115,908 E502G probably benign Het
Lck T C 4: 129,551,638 probably null Het
Mc3r C A 2: 172,249,690 Y277* probably null Het
Mlxipl T C 5: 135,133,604 V640A probably benign Het
Mrc2 A T 11: 105,332,343 N471Y probably damaging Het
Ncan T A 8: 70,102,017 H1050L probably damaging Het
Nrl C A 14: 55,522,432 V13F probably damaging Het
Obscn T A 11: 59,076,256 Y546F probably damaging Het
Olfr214 A G 6: 116,557,113 I229M probably damaging Het
Olfr654 T G 7: 104,587,890 S46A probably benign Het
Olfr799 A G 10: 129,648,091 probably null Het
Pde3b G A 7: 114,521,692 G684D probably damaging Het
Prkaa1 C T 15: 5,174,342 T244I probably benign Het
Scfd2 A T 5: 74,206,398 probably null Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Smg1 A T 7: 118,145,590 V3113D possibly damaging Het
Sorbs1 T C 19: 40,376,881 T153A probably benign Het
Spag16 A G 1: 69,870,289 T182A probably benign Het
Svs2 T C 2: 164,237,669 K106R possibly damaging Het
Tenm1 A G X: 43,074,695 V107A possibly damaging Het
Topaz1 A T 9: 122,799,485 I1546F possibly damaging Het
Tubgcp2 C A 7: 140,032,225 E78* probably null Het
Vars A G 17: 35,005,481 probably null Het
Vmn2r109 A T 17: 20,554,305 W263R probably benign Het
Other mutations in Klc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00594:Klc1 APN 12 111776884 missense probably damaging 1.00
IGL00940:Klc1 APN 12 111787498 missense probably damaging 1.00
IGL02206:Klc1 APN 12 111778116 unclassified probably benign
IGL02487:Klc1 APN 12 111772452 missense probably damaging 0.99
IGL02490:Klc1 APN 12 111781776 missense possibly damaging 0.89
IGL02830:Klc1 APN 12 111776907 missense probably damaging 0.99
IGL03121:Klc1 APN 12 111781642 unclassified probably benign
IGL03253:Klc1 APN 12 111781644 unclassified probably benign
IGL03376:Klc1 APN 12 111775953 missense probably damaging 0.97
dwarf UTSW 12 111795603 missense probably damaging 1.00
F5770:Klc1 UTSW 12 111774572 missense probably benign 0.09
R0031:Klc1 UTSW 12 111777033 missense probably damaging 0.99
R0239:Klc1 UTSW 12 111785324 splice site probably benign
R1647:Klc1 UTSW 12 111776887 missense probably damaging 1.00
R1648:Klc1 UTSW 12 111776887 missense probably damaging 1.00
R1892:Klc1 UTSW 12 111781827 critical splice donor site probably null
R2940:Klc1 UTSW 12 111806017 missense possibly damaging 0.49
R4829:Klc1 UTSW 12 111795603 missense probably damaging 1.00
R4849:Klc1 UTSW 12 111781695 missense probably damaging 1.00
R5309:Klc1 UTSW 12 111795621 missense possibly damaging 0.82
R5312:Klc1 UTSW 12 111795621 missense possibly damaging 0.82
R5637:Klc1 UTSW 12 111774408 missense probably damaging 1.00
R6623:Klc1 UTSW 12 111806041 missense probably damaging 1.00
R6920:Klc1 UTSW 12 111787585 missense probably damaging 1.00
R7109:Klc1 UTSW 12 111776865 missense probably benign 0.22
R7538:Klc1 UTSW 12 111785445 missense probably benign 0.01
R8051:Klc1 UTSW 12 111781950 missense possibly damaging 0.58
V7580:Klc1 UTSW 12 111774572 missense probably benign 0.09
V7581:Klc1 UTSW 12 111774572 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- ACATGTCTGTGCTCACTGC -3'
(R):5'- TCTGAACAGAATCAAGGCGC -3'

Sequencing Primer
(F):5'- TCTGGCAGGACTCACGTG -3'
(R):5'- TTTGAGCCTCGACCAGCCAG -3'
Posted On2017-01-03