Incidental Mutation 'R0551:Brwd1'
ID45199
Institutional Source Beutler Lab
Gene Symbol Brwd1
Ensembl Gene ENSMUSG00000022914
Gene Namebromodomain and WD repeat domain containing 1
SynonymsG1-403-16, repro5, D530019K20Rik, 5330419I02Rik, Wdr9
MMRRC Submission 038743-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0551 (G1)
Quality Score212
Status Validated
Chromosome16
Chromosomal Location95992092-96082428 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 96035974 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 886 (R886H)
Ref Sequence ENSEMBL: ENSMUSP00000097101 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023631] [ENSMUST00000099502] [ENSMUST00000113829] [ENSMUST00000124370] [ENSMUST00000131322] [ENSMUST00000153398]
Predicted Effect probably damaging
Transcript: ENSMUST00000023631
AA Change: R886H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023631
Gene: ENSMUSG00000022914
AA Change: R886H

DomainStartEndE-ValueType
low complexity region 36 48 N/A INTRINSIC
WD40 175 214 1.3e-7 SMART
WD40 217 256 2.26e-7 SMART
WD40 259 302 1.83e-7 SMART
WD40 311 352 3.82e1 SMART
WD40 357 396 4.27e-8 SMART
WD40 417 454 8.59e-1 SMART
WD40 457 497 1.47e-6 SMART
WD40 504 544 9.21e0 SMART
low complexity region 660 676 N/A INTRINSIC
low complexity region 753 767 N/A INTRINSIC
low complexity region 852 868 N/A INTRINSIC
low complexity region 906 927 N/A INTRINSIC
BROMO 1156 1267 1.72e-6 SMART
low complexity region 1277 1292 N/A INTRINSIC
BROMO 1317 1422 2.65e-30 SMART
low complexity region 1497 1513 N/A INTRINSIC
low complexity region 1543 1558 N/A INTRINSIC
internal_repeat_1 1574 1762 1.42e-9 PROSPERO
low complexity region 1764 1775 N/A INTRINSIC
internal_repeat_1 1857 2050 1.42e-9 PROSPERO
low complexity region 2165 2174 N/A INTRINSIC
low complexity region 2260 2270 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000099502
AA Change: R886H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097101
Gene: ENSMUSG00000022914
AA Change: R886H

DomainStartEndE-ValueType
low complexity region 36 48 N/A INTRINSIC
WD40 175 214 1.3e-7 SMART
WD40 217 256 2.26e-7 SMART
WD40 259 302 1.83e-7 SMART
WD40 311 352 3.82e1 SMART
WD40 357 396 4.27e-8 SMART
WD40 417 454 8.59e-1 SMART
WD40 457 497 1.47e-6 SMART
WD40 504 544 9.21e0 SMART
low complexity region 660 676 N/A INTRINSIC
low complexity region 753 767 N/A INTRINSIC
low complexity region 852 868 N/A INTRINSIC
low complexity region 906 927 N/A INTRINSIC
BROMO 1156 1267 1.72e-6 SMART
low complexity region 1277 1292 N/A INTRINSIC
BROMO 1317 1422 2.65e-30 SMART
low complexity region 1497 1513 N/A INTRINSIC
low complexity region 1543 1558 N/A INTRINSIC
internal_repeat_1 1574 1762 1.42e-9 PROSPERO
low complexity region 1764 1775 N/A INTRINSIC
internal_repeat_1 1857 2050 1.42e-9 PROSPERO
low complexity region 2165 2174 N/A INTRINSIC
low complexity region 2260 2270 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113829
AA Change: R886H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109460
Gene: ENSMUSG00000022914
AA Change: R886H

DomainStartEndE-ValueType
low complexity region 36 48 N/A INTRINSIC
WD40 175 214 1.3e-7 SMART
WD40 217 256 2.26e-7 SMART
WD40 259 302 1.83e-7 SMART
WD40 311 352 3.82e1 SMART
WD40 357 396 4.27e-8 SMART
WD40 417 454 8.59e-1 SMART
WD40 457 497 1.47e-6 SMART
WD40 504 544 9.21e0 SMART
low complexity region 660 676 N/A INTRINSIC
low complexity region 753 767 N/A INTRINSIC
low complexity region 852 868 N/A INTRINSIC
low complexity region 906 927 N/A INTRINSIC
BROMO 1156 1267 1.72e-6 SMART
low complexity region 1277 1292 N/A INTRINSIC
BROMO 1317 1422 2.65e-30 SMART
low complexity region 1497 1513 N/A INTRINSIC
low complexity region 1543 1558 N/A INTRINSIC
internal_repeat_1 1574 1762 1.13e-9 PROSPERO
low complexity region 1764 1775 N/A INTRINSIC
internal_repeat_1 1857 2050 1.13e-9 PROSPERO
low complexity region 2165 2174 N/A INTRINSIC
low complexity region 2177 2188 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000124370
AA Change: R565H

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000118423
Gene: ENSMUSG00000022914
AA Change: R565H

DomainStartEndE-ValueType
WD40 34 75 3.82e1 SMART
WD40 80 119 4.27e-8 SMART
WD40 140 177 8.59e-1 SMART
WD40 180 220 1.47e-6 SMART
WD40 227 267 9.21e0 SMART
low complexity region 383 399 N/A INTRINSIC
low complexity region 476 490 N/A INTRINSIC
low complexity region 531 547 N/A INTRINSIC
low complexity region 585 602 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000131322
AA Change: R333H

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000118327
Gene: ENSMUSG00000022914
AA Change: R333H

DomainStartEndE-ValueType
low complexity region 107 123 N/A INTRINSIC
low complexity region 200 214 N/A INTRINSIC
low complexity region 299 315 N/A INTRINSIC
low complexity region 353 374 N/A INTRINSIC
Blast:BROMO 496 582 4e-37 BLAST
Blast:BROMO 603 627 5e-8 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146222
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148432
Predicted Effect probably damaging
Transcript: ENSMUST00000153398
AA Change: R886H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117066
Gene: ENSMUSG00000022914
AA Change: R886H

DomainStartEndE-ValueType
low complexity region 36 48 N/A INTRINSIC
WD40 175 214 1.3e-7 SMART
WD40 217 256 2.26e-7 SMART
WD40 259 302 1.83e-7 SMART
WD40 311 352 3.82e1 SMART
WD40 357 396 4.27e-8 SMART
WD40 417 454 8.59e-1 SMART
WD40 457 497 1.47e-6 SMART
WD40 504 544 9.21e0 SMART
low complexity region 660 676 N/A INTRINSIC
low complexity region 753 767 N/A INTRINSIC
low complexity region 852 868 N/A INTRINSIC
low complexity region 906 927 N/A INTRINSIC
BROMO 1156 1267 1.72e-6 SMART
low complexity region 1277 1292 N/A INTRINSIC
BROMO 1317 1422 2.65e-30 SMART
internal_repeat_1 1491 1957 1.45e-251 PROSPERO
internal_repeat_1 1956 2422 1.45e-251 PROSPERO
low complexity region 2630 2639 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184285
Meta Mutation Damage Score 0.2941 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD) residues which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes including cell cycle progression, signal transduction, apoptosis, and gene regulation. This protein contains 2 bromodomains and multiple WD repeats. This gene is located within the Down syndrome region-2 on chromosome 21. Alternative splicing of this gene generates multiple transcript variants encoding distinct isoforms. In mouse, this gene encodes a nuclear protein that has a polyglutamine-containing region that functions as a transcriptional activation domain which may regulate chromatin remodelling and associates with a component of the SWI/SNF chromatin remodelling complex.[provided by RefSeq, Jun 2011]
PHENOTYPE: Homozygous males and females are infertile. Spermiogenesis is impaired; males have low epididymal sperm concentration with low motility and abnormal sperm head morphology. Female oocytes commonly contain vacuoles and have low developmental competence to 2-cell and blastocyst stages. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T A 14: 32,662,641 T456S probably benign Het
5830473C10Rik C T 5: 90,572,719 P250S probably damaging Het
Acmsd A T 1: 127,766,333 K333N probably benign Het
Adcy2 T A 13: 68,796,539 K241N probably damaging Het
Aebp1 A G 11: 5,867,955 I77V probably benign Het
Ankrd35 A G 3: 96,683,960 T521A probably benign Het
Arap2 C T 5: 62,641,323 probably null Het
Arfgap3 A T 15: 83,343,137 C25S probably damaging Het
Arhgap20 T A 9: 51,825,825 probably benign Het
Arhgap39 C T 15: 76,734,886 D833N probably damaging Het
Auts2 T C 5: 131,440,469 E446G possibly damaging Het
Carm1 G A 9: 21,580,491 probably null Het
Cdc5l G A 17: 45,415,684 R321W probably damaging Het
Cfap54 A T 10: 93,025,122 M841K probably benign Het
Clca4b T A 3: 144,928,626 T69S probably damaging Het
Cpox A G 16: 58,675,390 I357V probably benign Het
Diaph3 C A 14: 86,910,100 V711L probably benign Het
Fabp3-ps1 T C 10: 86,732,040 probably benign Het
Fam120b A T 17: 15,431,643 probably benign Het
Fcho1 A G 8: 71,712,174 S488P probably benign Het
Flcn A G 11: 59,795,748 probably null Het
Flt3l A G 7: 45,132,266 W234R probably damaging Het
Fzd7 G T 1: 59,483,284 V109L probably damaging Het
G3bp1 A G 11: 55,489,143 N101S probably benign Het
Gadd45g A G 13: 51,847,927 E143G probably damaging Het
Ganab T G 19: 8,907,280 I149S probably benign Het
Garnl3 A G 2: 33,016,738 S413P probably damaging Het
Glis1 C T 4: 107,568,119 probably null Het
Gm11563 A G 11: 99,658,713 S72P unknown Het
Gpd1 T G 15: 99,720,629 I188S possibly damaging Het
Gria2 A G 3: 80,732,026 probably benign Het
H2afy2 A G 10: 61,741,166 S308P probably damaging Het
Hpcal4 G T 4: 123,189,055 A65S possibly damaging Het
Igsf10 G A 3: 59,328,668 T1364I probably benign Het
Kdm4a T C 4: 118,138,231 *1065W probably null Het
Klkb1 A G 8: 45,277,966 probably null Het
Lipo3 T C 19: 33,580,551 D147G probably damaging Het
Lrp1 A G 10: 127,571,958 S1821P probably benign Het
Manba T C 3: 135,517,973 I207T probably damaging Het
Mark3 T A 12: 111,633,634 S428T probably benign Het
Mfsd4a G A 1: 132,041,919 T348I probably damaging Het
Mfsd7a A G 5: 108,444,465 probably benign Het
Mybbp1a A G 11: 72,448,376 M880V probably benign Het
N4bp2 T A 5: 65,820,341 probably null Het
Nrd1 T G 4: 109,047,708 I712S probably damaging Het
Nup210 G A 6: 91,021,484 R774C possibly damaging Het
Obscn G A 11: 59,107,862 R1395* probably null Het
Olfr1454 T A 19: 13,064,294 D294E probably benign Het
Pcdh7 T C 5: 57,721,994 Y964H probably damaging Het
Plin4 T C 17: 56,106,756 T290A probably benign Het
Ppara T C 15: 85,787,105 probably benign Het
Psg21 T G 7: 18,652,640 probably null Het
Ptar1 C A 19: 23,720,340 N405K probably benign Het
Ralgps2 A G 1: 156,832,663 probably null Het
Rnf6 T A 5: 146,211,395 N271I possibly damaging Het
Sis T C 3: 72,925,407 D1019G possibly damaging Het
Slc37a3 A G 6: 39,352,754 probably benign Het
Slc6a12 G A 6: 121,356,918 V238I probably damaging Het
Sntg1 C A 1: 8,554,736 V279L possibly damaging Het
Sorbs1 T A 19: 40,311,816 E567D probably damaging Het
Sp110 C A 1: 85,589,100 probably benign Het
Ssu2 A G 6: 112,380,554 V175A possibly damaging Het
Stk36 G A 1: 74,616,621 E428K probably benign Het
Teddm1b A T 1: 153,875,344 I300F possibly damaging Het
Thy1 T C 9: 44,047,348 V129A probably damaging Het
Tiam2 T A 17: 3,428,954 M654K probably damaging Het
Tmem69 T C 4: 116,553,273 S167G probably benign Het
Tmem8 C A 17: 26,120,602 Q605K probably damaging Het
Tmem81 C G 1: 132,507,829 I124M probably damaging Het
Tspan10 A G 11: 120,444,418 D118G probably damaging Het
Tspo2 A G 17: 48,448,813 probably benign Het
Ttn G A 2: 76,908,328 Q4002* probably null Het
Tyro3 G A 2: 119,816,904 R834Q probably damaging Het
Ugt2b1 T C 5: 86,926,084 K139E probably benign Het
Vmn1r9 A T 6: 57,071,539 I200F probably benign Het
Other mutations in Brwd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00690:Brwd1 APN 16 96017586 missense probably damaging 1.00
IGL00974:Brwd1 APN 16 96043026 missense probably damaging 1.00
IGL01014:Brwd1 APN 16 96016173 missense probably benign 0.04
IGL01447:Brwd1 APN 16 96047379 nonsense probably null
IGL01459:Brwd1 APN 16 96047420 missense probably damaging 1.00
IGL01631:Brwd1 APN 16 96046466 missense probably damaging 1.00
IGL02184:Brwd1 APN 16 96013829 missense probably damaging 1.00
IGL02264:Brwd1 APN 16 96019456 missense probably damaging 0.98
IGL02679:Brwd1 APN 16 96002823 missense probably benign
IGL02833:Brwd1 APN 16 96052571 missense probably damaging 1.00
IGL02960:Brwd1 APN 16 96057466 missense probably damaging 1.00
IGL03053:Brwd1 APN 16 96017677 missense possibly damaging 0.75
IGL03074:Brwd1 APN 16 96011850 missense probably benign 0.00
IGL03135:Brwd1 APN 16 96021258 missense probably damaging 0.99
IGL03168:Brwd1 APN 16 96017677 missense possibly damaging 0.75
IGL03214:Brwd1 APN 16 96037900 missense probably benign 0.26
IGL03328:Brwd1 APN 16 96002725 missense probably damaging 0.99
Embers UTSW 16 96017604 missense probably damaging 1.00
Glowing UTSW 16 96035959 missense probably damaging 1.00
PIT4243001:Brwd1 UTSW 16 96002671 nonsense probably null
R0012:Brwd1 UTSW 16 96059652 missense probably damaging 0.98
R0012:Brwd1 UTSW 16 96059652 missense probably damaging 0.98
R0030:Brwd1 UTSW 16 96021256 missense probably damaging 1.00
R0135:Brwd1 UTSW 16 96047104 missense probably damaging 1.00
R0366:Brwd1 UTSW 16 96037964 nonsense probably null
R0586:Brwd1 UTSW 16 96043086 missense probably damaging 1.00
R0865:Brwd1 UTSW 16 96068584 missense probably damaging 1.00
R1226:Brwd1 UTSW 16 96031548 missense probably benign 0.35
R1329:Brwd1 UTSW 16 96003234 missense probably benign 0.07
R1378:Brwd1 UTSW 16 96041370 missense probably benign 0.06
R1420:Brwd1 UTSW 16 96036034 missense probably damaging 1.00
R1441:Brwd1 UTSW 16 96066151 missense probably damaging 0.99
R1484:Brwd1 UTSW 16 96028291 unclassified probably null
R1624:Brwd1 UTSW 16 96008144 missense possibly damaging 0.67
R1636:Brwd1 UTSW 16 96059641 missense probably damaging 1.00
R1988:Brwd1 UTSW 16 96021237 missense probably damaging 0.96
R1998:Brwd1 UTSW 16 96021288 missense probably damaging 1.00
R2066:Brwd1 UTSW 16 96046465 missense probably benign 0.01
R2898:Brwd1 UTSW 16 96066100 missense probably damaging 0.99
R2983:Brwd1 UTSW 16 96066574 missense probably damaging 0.98
R3966:Brwd1 UTSW 16 96044530 missense probably damaging 1.00
R4086:Brwd1 UTSW 16 96046372 missense probably benign 0.03
R4257:Brwd1 UTSW 16 96023496 missense probably damaging 1.00
R4290:Brwd1 UTSW 16 96017604 missense probably damaging 1.00
R4292:Brwd1 UTSW 16 96017604 missense probably damaging 1.00
R4293:Brwd1 UTSW 16 96017604 missense probably damaging 1.00
R4614:Brwd1 UTSW 16 96047359 missense probably damaging 1.00
R4771:Brwd1 UTSW 16 96003318 missense probably benign 0.00
R5025:Brwd1 UTSW 16 96053972 missense probably damaging 0.97
R5155:Brwd1 UTSW 16 96002793 nonsense probably null
R5229:Brwd1 UTSW 16 96002209 missense possibly damaging 0.87
R5246:Brwd1 UTSW 16 96002557 missense probably damaging 1.00
R5668:Brwd1 UTSW 16 96016150 missense probably damaging 1.00
R5763:Brwd1 UTSW 16 96033843 nonsense probably null
R5782:Brwd1 UTSW 16 96043043 nonsense probably null
R5831:Brwd1 UTSW 16 96019436 missense probably damaging 1.00
R5836:Brwd1 UTSW 16 96064758 missense probably damaging 1.00
R5906:Brwd1 UTSW 16 96058738 missense probably damaging 1.00
R5995:Brwd1 UTSW 16 96064787 missense probably damaging 1.00
R6143:Brwd1 UTSW 16 96002956 missense probably benign 0.00
R6241:Brwd1 UTSW 16 96013874 missense probably damaging 1.00
R6313:Brwd1 UTSW 16 96007941 missense probably benign 0.01
R6362:Brwd1 UTSW 16 96002307 missense probably damaging 1.00
R6551:Brwd1 UTSW 16 95993962 missense possibly damaging 0.55
R6736:Brwd1 UTSW 16 96068572 missense probably damaging 1.00
R6822:Brwd1 UTSW 16 96041274 missense probably benign 0.42
R7080:Brwd1 UTSW 16 96009530 missense probably benign 0.01
R7131:Brwd1 UTSW 16 96066498 missense probably damaging 1.00
R7208:Brwd1 UTSW 16 96035959 missense probably damaging 1.00
R7322:Brwd1 UTSW 16 96066119 missense probably damaging 1.00
R7483:Brwd1 UTSW 16 96056173 missense probably damaging 0.99
R7615:Brwd1 UTSW 16 96033839 missense probably damaging 0.96
R7621:Brwd1 UTSW 16 96064887 missense probably damaging 1.00
R7665:Brwd1 UTSW 16 96041343 missense probably benign 0.09
R7697:Brwd1 UTSW 16 96046401 missense probably benign 0.10
R7740:Brwd1 UTSW 16 96027368 missense probably damaging 1.00
X0017:Brwd1 UTSW 16 96044491 missense probably damaging 1.00
X0028:Brwd1 UTSW 16 96011923 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- TGCACAGAGTGAGGTTTGAGGTCC -3'
(R):5'- TGTTCAAGTTAAGCCGAAGCTCTCATC -3'

Sequencing Primer
(F):5'- gaaagaaagaaggaaggaaggaag -3'
(R):5'- AAGCCGAAGCTCTCATCTTTCTC -3'
Posted On2013-06-11