Incidental Mutation 'R0551:Brwd1'
ID 45199
Institutional Source Beutler Lab
Gene Symbol Brwd1
Ensembl Gene ENSMUSG00000022914
Gene Name bromodomain and WD repeat domain containing 1
Synonyms 5330419I02Rik, Wdr9, G1-403-16, D530019K20Rik, repro5
MMRRC Submission 038743-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0551 (G1)
Quality Score 212
Status Validated
Chromosome 16
Chromosomal Location 95793292-95883726 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 95837174 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 886 (R886H)
Ref Sequence ENSEMBL: ENSMUSP00000097101 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023631] [ENSMUST00000099502] [ENSMUST00000113829] [ENSMUST00000124370] [ENSMUST00000131322] [ENSMUST00000153398]
AlphaFold Q921C3
Predicted Effect probably damaging
Transcript: ENSMUST00000023631
AA Change: R886H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023631
Gene: ENSMUSG00000022914
AA Change: R886H

DomainStartEndE-ValueType
low complexity region 36 48 N/A INTRINSIC
WD40 175 214 1.3e-7 SMART
WD40 217 256 2.26e-7 SMART
WD40 259 302 1.83e-7 SMART
WD40 311 352 3.82e1 SMART
WD40 357 396 4.27e-8 SMART
WD40 417 454 8.59e-1 SMART
WD40 457 497 1.47e-6 SMART
WD40 504 544 9.21e0 SMART
low complexity region 660 676 N/A INTRINSIC
low complexity region 753 767 N/A INTRINSIC
low complexity region 852 868 N/A INTRINSIC
low complexity region 906 927 N/A INTRINSIC
BROMO 1156 1267 1.72e-6 SMART
low complexity region 1277 1292 N/A INTRINSIC
BROMO 1317 1422 2.65e-30 SMART
low complexity region 1497 1513 N/A INTRINSIC
low complexity region 1543 1558 N/A INTRINSIC
internal_repeat_1 1574 1762 1.42e-9 PROSPERO
low complexity region 1764 1775 N/A INTRINSIC
internal_repeat_1 1857 2050 1.42e-9 PROSPERO
low complexity region 2165 2174 N/A INTRINSIC
low complexity region 2260 2270 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000099502
AA Change: R886H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097101
Gene: ENSMUSG00000022914
AA Change: R886H

DomainStartEndE-ValueType
low complexity region 36 48 N/A INTRINSIC
WD40 175 214 1.3e-7 SMART
WD40 217 256 2.26e-7 SMART
WD40 259 302 1.83e-7 SMART
WD40 311 352 3.82e1 SMART
WD40 357 396 4.27e-8 SMART
WD40 417 454 8.59e-1 SMART
WD40 457 497 1.47e-6 SMART
WD40 504 544 9.21e0 SMART
low complexity region 660 676 N/A INTRINSIC
low complexity region 753 767 N/A INTRINSIC
low complexity region 852 868 N/A INTRINSIC
low complexity region 906 927 N/A INTRINSIC
BROMO 1156 1267 1.72e-6 SMART
low complexity region 1277 1292 N/A INTRINSIC
BROMO 1317 1422 2.65e-30 SMART
low complexity region 1497 1513 N/A INTRINSIC
low complexity region 1543 1558 N/A INTRINSIC
internal_repeat_1 1574 1762 1.42e-9 PROSPERO
low complexity region 1764 1775 N/A INTRINSIC
internal_repeat_1 1857 2050 1.42e-9 PROSPERO
low complexity region 2165 2174 N/A INTRINSIC
low complexity region 2260 2270 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113829
AA Change: R886H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109460
Gene: ENSMUSG00000022914
AA Change: R886H

DomainStartEndE-ValueType
low complexity region 36 48 N/A INTRINSIC
WD40 175 214 1.3e-7 SMART
WD40 217 256 2.26e-7 SMART
WD40 259 302 1.83e-7 SMART
WD40 311 352 3.82e1 SMART
WD40 357 396 4.27e-8 SMART
WD40 417 454 8.59e-1 SMART
WD40 457 497 1.47e-6 SMART
WD40 504 544 9.21e0 SMART
low complexity region 660 676 N/A INTRINSIC
low complexity region 753 767 N/A INTRINSIC
low complexity region 852 868 N/A INTRINSIC
low complexity region 906 927 N/A INTRINSIC
BROMO 1156 1267 1.72e-6 SMART
low complexity region 1277 1292 N/A INTRINSIC
BROMO 1317 1422 2.65e-30 SMART
low complexity region 1497 1513 N/A INTRINSIC
low complexity region 1543 1558 N/A INTRINSIC
internal_repeat_1 1574 1762 1.13e-9 PROSPERO
low complexity region 1764 1775 N/A INTRINSIC
internal_repeat_1 1857 2050 1.13e-9 PROSPERO
low complexity region 2165 2174 N/A INTRINSIC
low complexity region 2177 2188 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000124370
AA Change: R565H

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000118423
Gene: ENSMUSG00000022914
AA Change: R565H

DomainStartEndE-ValueType
WD40 34 75 3.82e1 SMART
WD40 80 119 4.27e-8 SMART
WD40 140 177 8.59e-1 SMART
WD40 180 220 1.47e-6 SMART
WD40 227 267 9.21e0 SMART
low complexity region 383 399 N/A INTRINSIC
low complexity region 476 490 N/A INTRINSIC
low complexity region 531 547 N/A INTRINSIC
low complexity region 585 602 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000131322
AA Change: R333H

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000118327
Gene: ENSMUSG00000022914
AA Change: R333H

DomainStartEndE-ValueType
low complexity region 107 123 N/A INTRINSIC
low complexity region 200 214 N/A INTRINSIC
low complexity region 299 315 N/A INTRINSIC
low complexity region 353 374 N/A INTRINSIC
Blast:BROMO 496 582 4e-37 BLAST
Blast:BROMO 603 627 5e-8 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146222
Predicted Effect probably damaging
Transcript: ENSMUST00000153398
AA Change: R886H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117066
Gene: ENSMUSG00000022914
AA Change: R886H

DomainStartEndE-ValueType
low complexity region 36 48 N/A INTRINSIC
WD40 175 214 1.3e-7 SMART
WD40 217 256 2.26e-7 SMART
WD40 259 302 1.83e-7 SMART
WD40 311 352 3.82e1 SMART
WD40 357 396 4.27e-8 SMART
WD40 417 454 8.59e-1 SMART
WD40 457 497 1.47e-6 SMART
WD40 504 544 9.21e0 SMART
low complexity region 660 676 N/A INTRINSIC
low complexity region 753 767 N/A INTRINSIC
low complexity region 852 868 N/A INTRINSIC
low complexity region 906 927 N/A INTRINSIC
BROMO 1156 1267 1.72e-6 SMART
low complexity region 1277 1292 N/A INTRINSIC
BROMO 1317 1422 2.65e-30 SMART
internal_repeat_1 1491 1957 1.45e-251 PROSPERO
internal_repeat_1 1956 2422 1.45e-251 PROSPERO
low complexity region 2630 2639 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184285
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148432
Meta Mutation Damage Score 0.2941 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD) residues which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes including cell cycle progression, signal transduction, apoptosis, and gene regulation. This protein contains 2 bromodomains and multiple WD repeats. This gene is located within the Down syndrome region-2 on chromosome 21. Alternative splicing of this gene generates multiple transcript variants encoding distinct isoforms. In mouse, this gene encodes a nuclear protein that has a polyglutamine-containing region that functions as a transcriptional activation domain which may regulate chromatin remodelling and associates with a component of the SWI/SNF chromatin remodelling complex.[provided by RefSeq, Jun 2011]
PHENOTYPE: Homozygous males and females are infertile. Spermiogenesis is impaired; males have low epididymal sperm concentration with low motility and abnormal sperm head morphology. Female oocytes commonly contain vacuoles and have low developmental competence to 2-cell and blastocyst stages. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T A 14: 32,384,598 (GRCm39) T456S probably benign Het
Acmsd A T 1: 127,694,070 (GRCm39) K333N probably benign Het
Adcy2 T A 13: 68,944,658 (GRCm39) K241N probably damaging Het
Aebp1 A G 11: 5,817,955 (GRCm39) I77V probably benign Het
Albfm1 C T 5: 90,720,578 (GRCm39) P250S probably damaging Het
Ankrd35 A G 3: 96,591,276 (GRCm39) T521A probably benign Het
Arap2 C T 5: 62,798,666 (GRCm39) probably null Het
Arfgap3 A T 15: 83,227,338 (GRCm39) C25S probably damaging Het
Arhgap20 T A 9: 51,737,125 (GRCm39) probably benign Het
Arhgap39 C T 15: 76,619,086 (GRCm39) D833N probably damaging Het
Auts2 T C 5: 131,469,307 (GRCm39) E446G possibly damaging Het
Carm1 G A 9: 21,491,787 (GRCm39) probably null Het
Cdc5l G A 17: 45,726,610 (GRCm39) R321W probably damaging Het
Cfap54 A T 10: 92,860,984 (GRCm39) M841K probably benign Het
Clca4b T A 3: 144,634,387 (GRCm39) T69S probably damaging Het
Cpox A G 16: 58,495,753 (GRCm39) I357V probably benign Het
Diaph3 C A 14: 87,147,536 (GRCm39) V711L probably benign Het
Fabp3-ps1 T C 10: 86,567,904 (GRCm39) probably benign Het
Fam120b A T 17: 15,651,905 (GRCm39) probably benign Het
Fcho1 A G 8: 72,164,818 (GRCm39) S488P probably benign Het
Flcn A G 11: 59,686,574 (GRCm39) probably null Het
Flt3l A G 7: 44,781,690 (GRCm39) W234R probably damaging Het
Fzd7 G T 1: 59,522,443 (GRCm39) V109L probably damaging Het
G3bp1 A G 11: 55,379,969 (GRCm39) N101S probably benign Het
Gadd45g A G 13: 52,001,963 (GRCm39) E143G probably damaging Het
Ganab T G 19: 8,884,644 (GRCm39) I149S probably benign Het
Garnl3 A G 2: 32,906,750 (GRCm39) S413P probably damaging Het
Glis1 C T 4: 107,425,316 (GRCm39) probably null Het
Gm11563 A G 11: 99,549,539 (GRCm39) S72P unknown Het
Gpd1 T G 15: 99,618,510 (GRCm39) I188S possibly damaging Het
Gria2 A G 3: 80,639,333 (GRCm39) probably benign Het
Hpcal4 G T 4: 123,082,848 (GRCm39) A65S possibly damaging Het
Igsf10 G A 3: 59,236,089 (GRCm39) T1364I probably benign Het
Kdm4a T C 4: 117,995,428 (GRCm39) *1065W probably null Het
Klkb1 A G 8: 45,731,003 (GRCm39) probably null Het
Lipo3 T C 19: 33,557,951 (GRCm39) D147G probably damaging Het
Lrp1 A G 10: 127,407,827 (GRCm39) S1821P probably benign Het
Macroh2a2 A G 10: 61,576,945 (GRCm39) S308P probably damaging Het
Manba T C 3: 135,223,734 (GRCm39) I207T probably damaging Het
Mark3 T A 12: 111,600,068 (GRCm39) S428T probably benign Het
Mfsd4a G A 1: 131,969,657 (GRCm39) T348I probably damaging Het
Mybbp1a A G 11: 72,339,202 (GRCm39) M880V probably benign Het
N4bp2 T A 5: 65,977,684 (GRCm39) probably null Het
Nrdc T G 4: 108,904,905 (GRCm39) I712S probably damaging Het
Nup210 G A 6: 90,998,466 (GRCm39) R774C possibly damaging Het
Obscn G A 11: 58,998,688 (GRCm39) R1395* probably null Het
Or5b102 T A 19: 13,041,658 (GRCm39) D294E probably benign Het
Pcdh7 T C 5: 57,879,336 (GRCm39) Y964H probably damaging Het
Pgap6 C A 17: 26,339,576 (GRCm39) Q605K probably damaging Het
Plin4 T C 17: 56,413,756 (GRCm39) T290A probably benign Het
Ppara T C 15: 85,671,306 (GRCm39) probably benign Het
Psg21 T G 7: 18,386,565 (GRCm39) probably null Het
Ptar1 C A 19: 23,697,704 (GRCm39) N405K probably benign Het
Ralgps2 A G 1: 156,660,233 (GRCm39) probably null Het
Rnf6 T A 5: 146,148,205 (GRCm39) N271I possibly damaging Het
Sis T C 3: 72,832,740 (GRCm39) D1019G possibly damaging Het
Slc37a3 A G 6: 39,329,688 (GRCm39) probably benign Het
Slc49a3 A G 5: 108,592,331 (GRCm39) probably benign Het
Slc6a12 G A 6: 121,333,877 (GRCm39) V238I probably damaging Het
Sntg1 C A 1: 8,624,960 (GRCm39) V279L possibly damaging Het
Sorbs1 T A 19: 40,300,260 (GRCm39) E567D probably damaging Het
Sp110 C A 1: 85,516,821 (GRCm39) probably benign Het
Ssu2 A G 6: 112,357,515 (GRCm39) V175A possibly damaging Het
Stk36 G A 1: 74,655,780 (GRCm39) E428K probably benign Het
Teddm1b A T 1: 153,751,090 (GRCm39) I300F possibly damaging Het
Thy1 T C 9: 43,958,645 (GRCm39) V129A probably damaging Het
Tiam2 T A 17: 3,479,229 (GRCm39) M654K probably damaging Het
Tmem69 T C 4: 116,410,470 (GRCm39) S167G probably benign Het
Tmem81 C G 1: 132,435,567 (GRCm39) I124M probably damaging Het
Tspan10 A G 11: 120,335,244 (GRCm39) D118G probably damaging Het
Tspo2 A G 17: 48,755,841 (GRCm39) probably benign Het
Ttn G A 2: 76,738,672 (GRCm39) Q4002* probably null Het
Tyro3 G A 2: 119,647,385 (GRCm39) R834Q probably damaging Het
Ugt2b1 T C 5: 87,073,943 (GRCm39) K139E probably benign Het
Vmn1r9 A T 6: 57,048,524 (GRCm39) I200F probably benign Het
Other mutations in Brwd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00690:Brwd1 APN 16 95,818,786 (GRCm39) missense probably damaging 1.00
IGL00974:Brwd1 APN 16 95,844,226 (GRCm39) missense probably damaging 1.00
IGL01014:Brwd1 APN 16 95,817,373 (GRCm39) missense probably benign 0.04
IGL01447:Brwd1 APN 16 95,848,579 (GRCm39) nonsense probably null
IGL01459:Brwd1 APN 16 95,848,620 (GRCm39) missense probably damaging 1.00
IGL01631:Brwd1 APN 16 95,847,666 (GRCm39) missense probably damaging 1.00
IGL02184:Brwd1 APN 16 95,815,029 (GRCm39) missense probably damaging 1.00
IGL02264:Brwd1 APN 16 95,820,656 (GRCm39) missense probably damaging 0.98
IGL02679:Brwd1 APN 16 95,804,023 (GRCm39) missense probably benign
IGL02833:Brwd1 APN 16 95,853,771 (GRCm39) missense probably damaging 1.00
IGL02960:Brwd1 APN 16 95,858,666 (GRCm39) missense probably damaging 1.00
IGL03053:Brwd1 APN 16 95,818,877 (GRCm39) missense possibly damaging 0.75
IGL03074:Brwd1 APN 16 95,813,050 (GRCm39) missense probably benign 0.00
IGL03135:Brwd1 APN 16 95,822,458 (GRCm39) missense probably damaging 0.99
IGL03168:Brwd1 APN 16 95,818,877 (GRCm39) missense possibly damaging 0.75
IGL03214:Brwd1 APN 16 95,839,100 (GRCm39) missense probably benign 0.26
IGL03328:Brwd1 APN 16 95,803,925 (GRCm39) missense probably damaging 0.99
bromide UTSW 16 95,866,087 (GRCm39) missense probably damaging 1.00
Embers UTSW 16 95,818,804 (GRCm39) missense probably damaging 1.00
Glowing UTSW 16 95,837,159 (GRCm39) missense probably damaging 1.00
Soporific UTSW 16 95,835,043 (GRCm39) nonsense probably null
G1citation:Brwd1 UTSW 16 95,842,474 (GRCm39) missense probably benign 0.42
PIT4243001:Brwd1 UTSW 16 95,803,871 (GRCm39) nonsense probably null
R0012:Brwd1 UTSW 16 95,860,852 (GRCm39) missense probably damaging 0.98
R0012:Brwd1 UTSW 16 95,860,852 (GRCm39) missense probably damaging 0.98
R0030:Brwd1 UTSW 16 95,822,456 (GRCm39) missense probably damaging 1.00
R0135:Brwd1 UTSW 16 95,848,304 (GRCm39) missense probably damaging 1.00
R0366:Brwd1 UTSW 16 95,839,164 (GRCm39) nonsense probably null
R0586:Brwd1 UTSW 16 95,844,286 (GRCm39) missense probably damaging 1.00
R0865:Brwd1 UTSW 16 95,869,784 (GRCm39) missense probably damaging 1.00
R1226:Brwd1 UTSW 16 95,832,748 (GRCm39) missense probably benign 0.35
R1329:Brwd1 UTSW 16 95,804,434 (GRCm39) missense probably benign 0.07
R1378:Brwd1 UTSW 16 95,842,570 (GRCm39) missense probably benign 0.06
R1420:Brwd1 UTSW 16 95,837,234 (GRCm39) missense probably damaging 1.00
R1441:Brwd1 UTSW 16 95,867,351 (GRCm39) missense probably damaging 0.99
R1484:Brwd1 UTSW 16 95,829,491 (GRCm39) splice site probably null
R1624:Brwd1 UTSW 16 95,809,344 (GRCm39) missense possibly damaging 0.67
R1636:Brwd1 UTSW 16 95,860,841 (GRCm39) missense probably damaging 1.00
R1988:Brwd1 UTSW 16 95,822,437 (GRCm39) missense probably damaging 0.96
R1998:Brwd1 UTSW 16 95,822,488 (GRCm39) missense probably damaging 1.00
R2066:Brwd1 UTSW 16 95,847,665 (GRCm39) missense probably benign 0.01
R2898:Brwd1 UTSW 16 95,867,300 (GRCm39) missense probably damaging 0.99
R2983:Brwd1 UTSW 16 95,867,774 (GRCm39) missense probably damaging 0.98
R3966:Brwd1 UTSW 16 95,845,730 (GRCm39) missense probably damaging 1.00
R4086:Brwd1 UTSW 16 95,847,572 (GRCm39) missense probably benign 0.03
R4257:Brwd1 UTSW 16 95,824,696 (GRCm39) missense probably damaging 1.00
R4290:Brwd1 UTSW 16 95,818,804 (GRCm39) missense probably damaging 1.00
R4292:Brwd1 UTSW 16 95,818,804 (GRCm39) missense probably damaging 1.00
R4293:Brwd1 UTSW 16 95,818,804 (GRCm39) missense probably damaging 1.00
R4614:Brwd1 UTSW 16 95,848,559 (GRCm39) missense probably damaging 1.00
R4771:Brwd1 UTSW 16 95,804,518 (GRCm39) missense probably benign 0.00
R5025:Brwd1 UTSW 16 95,855,172 (GRCm39) missense probably damaging 0.97
R5155:Brwd1 UTSW 16 95,803,993 (GRCm39) nonsense probably null
R5229:Brwd1 UTSW 16 95,803,409 (GRCm39) missense possibly damaging 0.87
R5246:Brwd1 UTSW 16 95,803,757 (GRCm39) missense probably damaging 1.00
R5668:Brwd1 UTSW 16 95,817,350 (GRCm39) missense probably damaging 1.00
R5763:Brwd1 UTSW 16 95,835,043 (GRCm39) nonsense probably null
R5782:Brwd1 UTSW 16 95,844,243 (GRCm39) nonsense probably null
R5831:Brwd1 UTSW 16 95,820,636 (GRCm39) missense probably damaging 1.00
R5836:Brwd1 UTSW 16 95,865,958 (GRCm39) missense probably damaging 1.00
R5906:Brwd1 UTSW 16 95,859,938 (GRCm39) missense probably damaging 1.00
R5995:Brwd1 UTSW 16 95,865,987 (GRCm39) missense probably damaging 1.00
R6143:Brwd1 UTSW 16 95,804,156 (GRCm39) missense probably benign 0.00
R6241:Brwd1 UTSW 16 95,815,074 (GRCm39) missense probably damaging 1.00
R6313:Brwd1 UTSW 16 95,809,141 (GRCm39) missense probably benign 0.01
R6362:Brwd1 UTSW 16 95,803,507 (GRCm39) missense probably damaging 1.00
R6551:Brwd1 UTSW 16 95,795,162 (GRCm39) missense possibly damaging 0.55
R6736:Brwd1 UTSW 16 95,869,772 (GRCm39) missense probably damaging 1.00
R6822:Brwd1 UTSW 16 95,842,474 (GRCm39) missense probably benign 0.42
R7080:Brwd1 UTSW 16 95,810,730 (GRCm39) missense probably benign 0.01
R7131:Brwd1 UTSW 16 95,867,698 (GRCm39) missense probably damaging 1.00
R7208:Brwd1 UTSW 16 95,837,159 (GRCm39) missense probably damaging 1.00
R7322:Brwd1 UTSW 16 95,867,319 (GRCm39) missense probably damaging 1.00
R7483:Brwd1 UTSW 16 95,857,373 (GRCm39) missense probably damaging 0.99
R7615:Brwd1 UTSW 16 95,835,039 (GRCm39) missense probably damaging 0.96
R7621:Brwd1 UTSW 16 95,866,087 (GRCm39) missense probably damaging 1.00
R7665:Brwd1 UTSW 16 95,842,543 (GRCm39) missense probably benign 0.09
R7697:Brwd1 UTSW 16 95,847,601 (GRCm39) missense probably benign 0.10
R7740:Brwd1 UTSW 16 95,828,568 (GRCm39) missense probably damaging 1.00
R8120:Brwd1 UTSW 16 95,820,649 (GRCm39) missense probably benign 0.23
R8187:Brwd1 UTSW 16 95,803,934 (GRCm39) missense probably damaging 0.98
R8359:Brwd1 UTSW 16 95,817,409 (GRCm39) missense probably damaging 1.00
R8480:Brwd1 UTSW 16 95,848,630 (GRCm39) missense probably damaging 0.98
R8511:Brwd1 UTSW 16 95,859,938 (GRCm39) missense probably damaging 1.00
R9046:Brwd1 UTSW 16 95,829,402 (GRCm39) missense probably damaging 1.00
R9074:Brwd1 UTSW 16 95,824,610 (GRCm39) missense
R9102:Brwd1 UTSW 16 95,869,725 (GRCm39) missense probably benign 0.43
R9115:Brwd1 UTSW 16 95,848,314 (GRCm39) missense probably damaging 1.00
R9130:Brwd1 UTSW 16 95,866,130 (GRCm39) missense probably damaging 1.00
R9200:Brwd1 UTSW 16 95,839,154 (GRCm39) missense probably benign 0.00
R9246:Brwd1 UTSW 16 95,804,016 (GRCm39) missense probably benign 0.00
R9407:Brwd1 UTSW 16 95,803,693 (GRCm39) missense possibly damaging 0.74
R9444:Brwd1 UTSW 16 95,855,180 (GRCm39) missense possibly damaging 0.89
R9451:Brwd1 UTSW 16 95,845,703 (GRCm39) missense probably damaging 1.00
R9673:Brwd1 UTSW 16 95,813,096 (GRCm39) missense probably benign 0.00
R9751:Brwd1 UTSW 16 95,795,015 (GRCm39) missense possibly damaging 0.83
R9753:Brwd1 UTSW 16 95,825,028 (GRCm39) missense probably damaging 1.00
X0017:Brwd1 UTSW 16 95,845,691 (GRCm39) missense probably damaging 1.00
X0028:Brwd1 UTSW 16 95,813,123 (GRCm39) missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- TGCACAGAGTGAGGTTTGAGGTCC -3'
(R):5'- TGTTCAAGTTAAGCCGAAGCTCTCATC -3'

Sequencing Primer
(F):5'- gaaagaaagaaggaaggaaggaag -3'
(R):5'- AAGCCGAAGCTCTCATCTTTCTC -3'
Posted On 2013-06-11