Incidental Mutation 'R5706:Nrl'
ID451990
Institutional Source Beutler Lab
Gene Symbol Nrl
Ensembl Gene ENSMUSG00000040632
Gene Nameneural retina leucine zipper gene
Synonyms
MMRRC Submission 043331-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.720) question?
Stock #R5706 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location55518978-55524981 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 55522432 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 13 (V13F)
Ref Sequence ENSEMBL: ENSMUSP00000153933 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062232] [ENSMUST00000111404] [ENSMUST00000178694] [ENSMUST00000228287] [ENSMUST00000228902]
Predicted Effect probably damaging
Transcript: ENSMUST00000062232
AA Change: V13F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000054457
Gene: ENSMUSG00000040632
AA Change: V13F

DomainStartEndE-ValueType
low complexity region 41 54 N/A INTRINSIC
Pfam:Maf_N 67 101 7.3e-18 PFAM
BRLZ 157 221 1.6e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111404
AA Change: V13F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107035
Gene: ENSMUSG00000040632
AA Change: V13F

DomainStartEndE-ValueType
low complexity region 41 54 N/A INTRINSIC
Pfam:Maf_N 67 102 2e-15 PFAM
BRLZ 157 221 1.6e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000178694
AA Change: V13F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000136445
Gene: ENSMUSG00000040632
AA Change: V13F

DomainStartEndE-ValueType
low complexity region 41 54 N/A INTRINSIC
Pfam:Maf_N 67 102 2e-15 PFAM
BRLZ 157 221 1.6e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226858
Predicted Effect probably damaging
Transcript: ENSMUST00000228287
AA Change: V13F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228351
Predicted Effect probably damaging
Transcript: ENSMUST00000228902
AA Change: V13F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the basic leucine zipper domain family of transcription factors. The encoded protein is preferentially expressed in the retina and is necessary for rod photoreceptor development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2012]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit a retinal defect causing loss of rod function, exaggerated cone function, short, sparse outer segments, and abnormal disks. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T A 3: 122,054,261 M77K probably benign Het
Amy1 A G 3: 113,556,120 V467A probably damaging Het
Atf4 T C 15: 80,256,330 V11A possibly damaging Het
B4galt1 T C 4: 40,807,268 N373D probably damaging Het
Bpifa3 A G 2: 154,135,578 K112R probably damaging Het
Chd2 T A 7: 73,491,357 Y596F possibly damaging Het
Clspn T C 4: 126,578,418 S962P probably damaging Het
Cyp2c68 T C 19: 39,734,318 D262G possibly damaging Het
Dcaf11 T C 14: 55,565,695 I282T probably damaging Het
Dmxl1 T C 18: 49,957,395 probably null Het
Dnah11 T G 12: 118,023,935 K2411Q probably damaging Het
Elf3 A G 1: 135,256,482 V196A probably benign Het
Fhad1 T G 4: 141,954,116 T538P probably damaging Het
Fkbp10 A G 11: 100,421,023 D174G probably damaging Het
Gas6 A G 8: 13,477,098 S217P probably damaging Het
Gm4778 T A 3: 94,266,652 H322Q possibly damaging Het
Heatr5b C T 17: 78,766,875 probably null Het
Iqgap3 A G 3: 88,115,908 E502G probably benign Het
Klc1 T C 12: 111,795,627 V577A possibly damaging Het
Lck T C 4: 129,551,638 probably null Het
Mc3r C A 2: 172,249,690 Y277* probably null Het
Mlxipl T C 5: 135,133,604 V640A probably benign Het
Mrc2 A T 11: 105,332,343 N471Y probably damaging Het
Ncan T A 8: 70,102,017 H1050L probably damaging Het
Obscn T A 11: 59,076,256 Y546F probably damaging Het
Olfr214 A G 6: 116,557,113 I229M probably damaging Het
Olfr654 T G 7: 104,587,890 S46A probably benign Het
Olfr799 A G 10: 129,648,091 probably null Het
Pde3b G A 7: 114,521,692 G684D probably damaging Het
Prkaa1 C T 15: 5,174,342 T244I probably benign Het
Scfd2 A T 5: 74,206,398 probably null Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Smg1 A T 7: 118,145,590 V3113D possibly damaging Het
Sorbs1 T C 19: 40,376,881 T153A probably benign Het
Spag16 A G 1: 69,870,289 T182A probably benign Het
Svs2 T C 2: 164,237,669 K106R possibly damaging Het
Tenm1 A G X: 43,074,695 V107A possibly damaging Het
Topaz1 A T 9: 122,799,485 I1546F possibly damaging Het
Tubgcp2 C A 7: 140,032,225 E78* probably null Het
Vars A G 17: 35,005,481 probably null Het
Vmn2r109 A T 17: 20,554,305 W263R probably benign Het
Other mutations in Nrl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02039:Nrl APN 14 55522110 missense probably benign 0.00
R1940:Nrl UTSW 14 55522435 missense probably damaging 1.00
R2144:Nrl UTSW 14 55520850 missense possibly damaging 0.50
R2311:Nrl UTSW 14 55522452 missense probably damaging 1.00
R4424:Nrl UTSW 14 55522218 missense probably benign 0.04
R7859:Nrl UTSW 14 55522125 missense probably benign 0.01
R8328:Nrl UTSW 14 55520706 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGGCCAGCCAATATAGCTCCTC -3'
(R):5'- TGGATCTGTACTCTGGAATCCC -3'

Sequencing Primer
(F):5'- AATATAGCTCCTCCAGGCCTG -3'
(R):5'- ATCACTAGTTCCAGGGAAATTGGGTC -3'
Posted On2017-01-03