Incidental Mutation 'R5706:Dcaf11'
ID451991
Institutional Source Beutler Lab
Gene Symbol Dcaf11
Ensembl Gene ENSMUSG00000022214
Gene NameDDB1 and CUL4 associated factor 11
Synonyms0710008A13Rik, GLO14, D14Ucla1, Wdr23
MMRRC Submission 043331-MU
Accession Numbers

Genbank: NM_133734; MGI: 90168

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5706 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location55560006-55570065 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 55565695 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 282 (I282T)
Ref Sequence ENSEMBL: ENSMUSP00000113620 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072530] [ENSMUST00000117236] [ENSMUST00000117701] [ENSMUST00000121622] [ENSMUST00000128490] [ENSMUST00000133256] [ENSMUST00000143375] [ENSMUST00000143431] [ENSMUST00000147981] [ENSMUST00000152681] [ENSMUST00000150019] [ENSMUST00000150481]
AlphaFold Q91VU6
Predicted Effect probably damaging
Transcript: ENSMUST00000072530
AA Change: I322T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000072344
Gene: ENSMUSG00000022214
AA Change: I322T

DomainStartEndE-ValueType
low complexity region 2 42 N/A INTRINSIC
low complexity region 49 62 N/A INTRINSIC
WD40 162 200 8.91e-1 SMART
WD40 205 246 8.25e0 SMART
WD40 252 293 2.39e0 SMART
WD40 296 336 1.44e-5 SMART
WD40 344 383 1.26e-5 SMART
WD40 424 469 1.72e0 SMART
WD40 472 511 1.49e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000117236
AA Change: I322T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113014
Gene: ENSMUSG00000022214
AA Change: I322T

DomainStartEndE-ValueType
low complexity region 2 42 N/A INTRINSIC
low complexity region 49 62 N/A INTRINSIC
WD40 162 200 8.91e-1 SMART
WD40 205 246 8.25e0 SMART
WD40 252 293 2.39e0 SMART
WD40 296 336 1.44e-5 SMART
WD40 344 383 1.26e-5 SMART
WD40 424 469 1.72e0 SMART
WD40 472 511 1.49e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000117701
AA Change: I282T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113620
Gene: ENSMUSG00000022214
AA Change: I282T

DomainStartEndE-ValueType
low complexity region 2 42 N/A INTRINSIC
WD40 122 160 8.91e-1 SMART
WD40 165 206 8.25e0 SMART
WD40 212 253 2.39e0 SMART
WD40 256 296 1.44e-5 SMART
WD40 304 343 1.26e-5 SMART
WD40 384 429 1.72e0 SMART
WD40 432 471 1.49e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000121622
AA Change: I322T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113202
Gene: ENSMUSG00000022214
AA Change: I322T

DomainStartEndE-ValueType
low complexity region 2 42 N/A INTRINSIC
low complexity region 49 62 N/A INTRINSIC
WD40 162 200 8.91e-1 SMART
WD40 205 246 8.25e0 SMART
WD40 252 293 2.39e0 SMART
WD40 296 336 1.44e-5 SMART
WD40 344 383 1.26e-5 SMART
WD40 424 469 1.72e0 SMART
WD40 472 511 1.49e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127991
Predicted Effect probably damaging
Transcript: ENSMUST00000128490
AA Change: I322T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000114211
Gene: ENSMUSG00000022214
AA Change: I322T

DomainStartEndE-ValueType
low complexity region 2 42 N/A INTRINSIC
low complexity region 49 62 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129310
Predicted Effect probably benign
Transcript: ENSMUST00000133256
SMART Domains Protein: ENSMUSP00000118404
Gene: ENSMUSG00000022214

DomainStartEndE-ValueType
low complexity region 2 42 N/A INTRINSIC
low complexity region 49 62 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135068
Predicted Effect probably benign
Transcript: ENSMUST00000143375
SMART Domains Protein: ENSMUSP00000121570
Gene: ENSMUSG00000022214

DomainStartEndE-ValueType
low complexity region 2 42 N/A INTRINSIC
low complexity region 49 62 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143431
SMART Domains Protein: ENSMUSP00000118762
Gene: ENSMUSG00000022214

DomainStartEndE-ValueType
low complexity region 2 42 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145983
Predicted Effect probably benign
Transcript: ENSMUST00000147981
SMART Domains Protein: ENSMUSP00000123453
Gene: ENSMUSG00000022214

DomainStartEndE-ValueType
low complexity region 2 42 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153638
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155029
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151245
Predicted Effect probably benign
Transcript: ENSMUST00000152681
SMART Domains Protein: ENSMUSP00000120296
Gene: ENSMUSG00000022214

DomainStartEndE-ValueType
low complexity region 2 42 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150019
SMART Domains Protein: ENSMUSP00000117617
Gene: ENSMUSG00000022214

DomainStartEndE-ValueType
low complexity region 2 42 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150481
SMART Domains Protein: ENSMUSP00000119001
Gene: ENSMUSG00000022214

DomainStartEndE-ValueType
low complexity region 2 42 N/A INTRINSIC
low complexity region 49 62 N/A INTRINSIC
WD40 162 200 8.91e-1 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a WD repeat-containing protein that interacts with the COP9 signalosome, a macromolecular complex that interacts with cullin-RING E3 ligases and regulates their activity by hydrolyzing cullin-Nedd8 conjugates. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2009]
Allele List at MGI

All alleles(2) : Gene trapped(2)

Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T A 3: 122,054,261 M77K probably benign Het
Amy1 A G 3: 113,556,120 V467A probably damaging Het
Atf4 T C 15: 80,256,330 V11A possibly damaging Het
B4galt1 T C 4: 40,807,268 N373D probably damaging Het
Bpifa3 A G 2: 154,135,578 K112R probably damaging Het
Chd2 T A 7: 73,491,357 Y596F possibly damaging Het
Clspn T C 4: 126,578,418 S962P probably damaging Het
Cyp2c68 T C 19: 39,734,318 D262G possibly damaging Het
Dmxl1 T C 18: 49,957,395 probably null Het
Dnah11 T G 12: 118,023,935 K2411Q probably damaging Het
Elf3 A G 1: 135,256,482 V196A probably benign Het
Fhad1 T G 4: 141,954,116 T538P probably damaging Het
Fkbp10 A G 11: 100,421,023 D174G probably damaging Het
Gas6 A G 8: 13,477,098 S217P probably damaging Het
Gm4778 T A 3: 94,266,652 H322Q possibly damaging Het
Heatr5b C T 17: 78,766,875 probably null Het
Iqgap3 A G 3: 88,115,908 E502G probably benign Het
Klc1 T C 12: 111,795,627 V577A possibly damaging Het
Lck T C 4: 129,551,638 probably null Het
Mc3r C A 2: 172,249,690 Y277* probably null Het
Mlxipl T C 5: 135,133,604 V640A probably benign Het
Mrc2 A T 11: 105,332,343 N471Y probably damaging Het
Ncan T A 8: 70,102,017 H1050L probably damaging Het
Nrl C A 14: 55,522,432 V13F probably damaging Het
Obscn T A 11: 59,076,256 Y546F probably damaging Het
Olfr214 A G 6: 116,557,113 I229M probably damaging Het
Olfr654 T G 7: 104,587,890 S46A probably benign Het
Olfr799 A G 10: 129,648,091 probably null Het
Pde3b G A 7: 114,521,692 G684D probably damaging Het
Prkaa1 C T 15: 5,174,342 T244I probably benign Het
Scfd2 A T 5: 74,206,398 probably null Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Smg1 A T 7: 118,145,590 V3113D possibly damaging Het
Sorbs1 T C 19: 40,376,881 T153A probably benign Het
Spag16 A G 1: 69,870,289 T182A probably benign Het
Svs2 T C 2: 164,237,669 K106R possibly damaging Het
Tenm1 A G X: 43,074,695 V107A possibly damaging Het
Topaz1 A T 9: 122,799,485 I1546F possibly damaging Het
Tubgcp2 C A 7: 140,032,225 E78* probably null Het
Vars A G 17: 35,005,481 probably null Het
Vmn2r109 A T 17: 20,554,305 W263R probably benign Het
Other mutations in Dcaf11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00857:Dcaf11 APN 14 55561285 utr 5 prime probably benign
IGL02158:Dcaf11 APN 14 55564523 splice site probably null
IGL02487:Dcaf11 APN 14 55569114 missense probably benign 0.06
IGL02887:Dcaf11 APN 14 55564135 missense probably damaging 1.00
IGL03263:Dcaf11 APN 14 55565492 missense probably damaging 0.99
IGL03392:Dcaf11 APN 14 55561421 missense probably damaging 1.00
R0057:Dcaf11 UTSW 14 55569310 missense probably benign 0.06
R0057:Dcaf11 UTSW 14 55569310 missense probably benign 0.06
R0084:Dcaf11 UTSW 14 55569243 missense probably benign 0.00
R0110:Dcaf11 UTSW 14 55569080 missense probably damaging 1.00
R0450:Dcaf11 UTSW 14 55569080 missense probably damaging 1.00
R0510:Dcaf11 UTSW 14 55569080 missense probably damaging 1.00
R0662:Dcaf11 UTSW 14 55565507 missense possibly damaging 0.93
R1087:Dcaf11 UTSW 14 55569124 missense probably damaging 0.96
R2281:Dcaf11 UTSW 14 55569371 makesense probably null
R2698:Dcaf11 UTSW 14 55566885 missense probably damaging 1.00
R2866:Dcaf11 UTSW 14 55565745 missense possibly damaging 0.92
R4472:Dcaf11 UTSW 14 55565606 intron probably benign
R5288:Dcaf11 UTSW 14 55563376 missense probably damaging 1.00
R5682:Dcaf11 UTSW 14 55563426 missense probably damaging 1.00
R7133:Dcaf11 UTSW 14 55568926 splice site probably null
R7468:Dcaf11 UTSW 14 55565509 missense possibly damaging 0.70
R7673:Dcaf11 UTSW 14 55569305 missense probably benign 0.00
R8755:Dcaf11 UTSW 14 55560566 start gained probably benign
R8861:Dcaf11 UTSW 14 55564498 nonsense probably null
R8959:Dcaf11 UTSW 14 55569304 missense probably benign 0.00
R9038:Dcaf11 UTSW 14 55565657 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGGCGTACTCTTCAGGTATTG -3'
(R):5'- GACAGCCAGAACCTTGAGAG -3'

Sequencing Primer
(F):5'- GTTTGTGAGACAAGAGCCTTCTCC -3'
(R):5'- ATAAAGGTGATGCCATCCTAGTGCC -3'
Posted On2017-01-03