Incidental Mutation 'R5706:Prkaa1'
ID451992
Institutional Source Beutler Lab
Gene Symbol Prkaa1
Ensembl Gene ENSMUSG00000050697
Gene Nameprotein kinase, AMP-activated, alpha 1 catalytic subunit
SynonymsC130083N04Rik, AMPKalpha1
MMRRC Submission 043331-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5706 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location5143861-5181899 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 5174342 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 244 (T244I)
Ref Sequence ENSEMBL: ENSMUSP00000063166 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051186] [ENSMUST00000228218]
Predicted Effect probably benign
Transcript: ENSMUST00000051186
AA Change: T244I

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000063166
Gene: ENSMUSG00000050697
AA Change: T244I

DomainStartEndE-ValueType
S_TKc 27 279 2.23e-103 SMART
low complexity region 305 318 N/A INTRINSIC
Pfam:AdenylateSensor 406 503 1.3e-15 PFAM
low complexity region 516 535 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150079
Predicted Effect probably benign
Transcript: ENSMUST00000228218
AA Change: T235I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the ser/thr protein kinase family. It is the catalytic subunit of the 5'-prime-AMP-activated protein kinase (AMPK). AMPK is a cellular energy sensor conserved in all eukaryotic cells. The kinase activity of AMPK is activated by the stimuli that increase the cellular AMP/ATP ratio. AMPK regulates the activities of a number of key metabolic enzymes through phosphorylation. It protects cells from stresses that cause ATP depletion by switching off ATP-consuming biosynthetic pathways. Alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased muscle cell glucose uptake. Mice homozygous for a different knock-out allele exhibit anemia, reticulocytosis, splenomegaly, increased erythrocyte turnover, and elevated plasma erythropoietin levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T A 3: 122,054,261 M77K probably benign Het
Amy1 A G 3: 113,556,120 V467A probably damaging Het
Atf4 T C 15: 80,256,330 V11A possibly damaging Het
B4galt1 T C 4: 40,807,268 N373D probably damaging Het
Bpifa3 A G 2: 154,135,578 K112R probably damaging Het
Chd2 T A 7: 73,491,357 Y596F possibly damaging Het
Clspn T C 4: 126,578,418 S962P probably damaging Het
Cyp2c68 T C 19: 39,734,318 D262G possibly damaging Het
Dcaf11 T C 14: 55,565,695 I282T probably damaging Het
Dmxl1 T C 18: 49,957,395 probably null Het
Dnah11 T G 12: 118,023,935 K2411Q probably damaging Het
Elf3 A G 1: 135,256,482 V196A probably benign Het
Fhad1 T G 4: 141,954,116 T538P probably damaging Het
Fkbp10 A G 11: 100,421,023 D174G probably damaging Het
Gas6 A G 8: 13,477,098 S217P probably damaging Het
Gm4778 T A 3: 94,266,652 H322Q possibly damaging Het
Heatr5b C T 17: 78,766,875 probably null Het
Iqgap3 A G 3: 88,115,908 E502G probably benign Het
Klc1 T C 12: 111,795,627 V577A possibly damaging Het
Lck T C 4: 129,551,638 probably null Het
Mc3r C A 2: 172,249,690 Y277* probably null Het
Mlxipl T C 5: 135,133,604 V640A probably benign Het
Mrc2 A T 11: 105,332,343 N471Y probably damaging Het
Ncan T A 8: 70,102,017 H1050L probably damaging Het
Nrl C A 14: 55,522,432 V13F probably damaging Het
Obscn T A 11: 59,076,256 Y546F probably damaging Het
Olfr214 A G 6: 116,557,113 I229M probably damaging Het
Olfr654 T G 7: 104,587,890 S46A probably benign Het
Olfr799 A G 10: 129,648,091 probably null Het
Pde3b G A 7: 114,521,692 G684D probably damaging Het
Scfd2 A T 5: 74,206,398 probably null Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Smg1 A T 7: 118,145,590 V3113D possibly damaging Het
Sorbs1 T C 19: 40,376,881 T153A probably benign Het
Spag16 A G 1: 69,870,289 T182A probably benign Het
Svs2 T C 2: 164,237,669 K106R possibly damaging Het
Tenm1 A G X: 43,074,695 V107A possibly damaging Het
Topaz1 A T 9: 122,799,485 I1546F possibly damaging Het
Tubgcp2 C A 7: 140,032,225 E78* probably null Het
Vars A G 17: 35,005,481 probably null Het
Vmn2r109 A T 17: 20,554,305 W263R probably benign Het
Other mutations in Prkaa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01100:Prkaa1 APN 15 5174318 missense probably damaging 1.00
IGL01797:Prkaa1 APN 15 5168706 missense probably damaging 1.00
IGL02442:Prkaa1 APN 15 5176888 missense probably damaging 1.00
IGL02890:Prkaa1 APN 15 5177086 missense possibly damaging 0.91
IGL03146:Prkaa1 APN 15 5168641 missense probably damaging 0.99
IGL03396:Prkaa1 APN 15 5176650 missense probably damaging 1.00
pressor UTSW 15 5176956 missense probably damaging 1.00
R1439:Prkaa1 UTSW 15 5164744 missense probably damaging 0.99
R1466:Prkaa1 UTSW 15 5178798 missense probably benign
R1466:Prkaa1 UTSW 15 5178798 missense probably benign
R1804:Prkaa1 UTSW 15 5178778 missense probably benign 0.41
R1807:Prkaa1 UTSW 15 5143954 missense probably damaging 1.00
R4381:Prkaa1 UTSW 15 5176808 missense probably benign
R4398:Prkaa1 UTSW 15 5177161 missense possibly damaging 0.58
R4579:Prkaa1 UTSW 15 5160601 critical splice acceptor site probably null
R4689:Prkaa1 UTSW 15 5178696 missense probably benign
R4832:Prkaa1 UTSW 15 5160620 missense probably damaging 0.96
R4874:Prkaa1 UTSW 15 5174357 missense probably benign 0.16
R4876:Prkaa1 UTSW 15 5174405 missense probably benign 0.44
R5074:Prkaa1 UTSW 15 5176911 missense possibly damaging 0.82
R5260:Prkaa1 UTSW 15 5160668 missense probably damaging 1.00
R5563:Prkaa1 UTSW 15 5169956 missense probably damaging 1.00
R6363:Prkaa1 UTSW 15 5176956 missense probably damaging 1.00
R6825:Prkaa1 UTSW 15 5143950 missense possibly damaging 0.91
R7090:Prkaa1 UTSW 15 5177130 missense probably benign
R7921:Prkaa1 UTSW 15 5177151 missense probably damaging 1.00
R7989:Prkaa1 UTSW 15 5176685 missense probably damaging 1.00
R8289:Prkaa1 UTSW 15 5177082 missense possibly damaging 0.88
R8314:Prkaa1 UTSW 15 5178873 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTGAAGAGTGTTGACCGATGC -3'
(R):5'- TCTGGTATCTAGAGACTCGAAAAG -3'

Sequencing Primer
(F):5'- AAGAGTGTTGACCGATGCTTTTTG -3'
(R):5'- TGCTGTGCAATGGTAATACCACG -3'
Posted On2017-01-03