Incidental Mutation 'R5706:Atf4'
ID451993
Institutional Source Beutler Lab
Gene Symbol Atf4
Ensembl Gene ENSMUSG00000042406
Gene Nameactivating transcription factor 4
SynonymsCREB2, C/ATF, Atf-4, TAXREB67
MMRRC Submission 043331-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5706 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location80255184-80257541 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 80256330 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 11 (V11A)
Ref Sequence ENSEMBL: ENSMUSP00000105234 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023048] [ENSMUST00000052499] [ENSMUST00000109605] [ENSMUST00000228788] [ENSMUST00000229138] [ENSMUST00000229828]
Predicted Effect probably benign
Transcript: ENSMUST00000023048
SMART Domains Protein: ENSMUSP00000023048
Gene: ENSMUSG00000022412

DomainStartEndE-ValueType
transmembrane domain 24 46 N/A INTRINSIC
Mab-21 189 455 7.09e-84 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000052499
SMART Domains Protein: ENSMUSP00000061167
Gene: ENSMUSG00000051518

DomainStartEndE-ValueType
Pfam:AROS 23 141 6.4e-42 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000109605
AA Change: V11A

PolyPhen 2 Score 0.832 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000105234
Gene: ENSMUSG00000042406
AA Change: V11A

DomainStartEndE-ValueType
low complexity region 23 34 N/A INTRINSIC
low complexity region 101 121 N/A INTRINSIC
low complexity region 246 257 N/A INTRINSIC
BRLZ 274 338 6.16e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000228788
Predicted Effect probably benign
Transcript: ENSMUST00000229138
Predicted Effect possibly damaging
Transcript: ENSMUST00000229828
AA Change: V11A

PolyPhen 2 Score 0.529 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229962
Predicted Effect probably benign
Transcript: ENSMUST00000230189
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230434
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that was originally identified as a widely expressed mammalian DNA binding protein that could bind a tax-responsive enhancer element in the LTR of HTLV-1. The encoded protein was also isolated and characterized as the cAMP-response element binding protein 2 (CREB-2). The protein encoded by this gene belongs to a family of DNA-binding proteins that includes the AP-1 family of transcription factors, cAMP-response element binding proteins (CREBs) and CREB-like proteins. These transcription factors share a leucine zipper region that is involved in protein-protein interactions, located C-terminal to a stretch of basic amino acids that functions as a DNA binding domain. Two alternative transcripts encoding the same protein have been described. Two pseudogenes are located on the X chromosome at q28 in a region containing a large inverted duplication. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for one knock-out allele exhibit postnatal lethality, abnormal lens development, and reduced male fertility. Mice homozygous for a different knock-out allele exhibit abnormal pancreatic and skeletal development, glucose homeostasis, and insulin homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T A 3: 122,054,261 M77K probably benign Het
Amy1 A G 3: 113,556,120 V467A probably damaging Het
B4galt1 T C 4: 40,807,268 N373D probably damaging Het
Bpifa3 A G 2: 154,135,578 K112R probably damaging Het
Chd2 T A 7: 73,491,357 Y596F possibly damaging Het
Clspn T C 4: 126,578,418 S962P probably damaging Het
Cyp2c68 T C 19: 39,734,318 D262G possibly damaging Het
Dcaf11 T C 14: 55,565,695 I282T probably damaging Het
Dmxl1 T C 18: 49,957,395 probably null Het
Dnah11 T G 12: 118,023,935 K2411Q probably damaging Het
Elf3 A G 1: 135,256,482 V196A probably benign Het
Fhad1 T G 4: 141,954,116 T538P probably damaging Het
Fkbp10 A G 11: 100,421,023 D174G probably damaging Het
Gas6 A G 8: 13,477,098 S217P probably damaging Het
Gm4778 T A 3: 94,266,652 H322Q possibly damaging Het
Heatr5b C T 17: 78,766,875 probably null Het
Iqgap3 A G 3: 88,115,908 E502G probably benign Het
Klc1 T C 12: 111,795,627 V577A possibly damaging Het
Lck T C 4: 129,551,638 probably null Het
Mc3r C A 2: 172,249,690 Y277* probably null Het
Mlxipl T C 5: 135,133,604 V640A probably benign Het
Mrc2 A T 11: 105,332,343 N471Y probably damaging Het
Ncan T A 8: 70,102,017 H1050L probably damaging Het
Nrl C A 14: 55,522,432 V13F probably damaging Het
Obscn T A 11: 59,076,256 Y546F probably damaging Het
Olfr214 A G 6: 116,557,113 I229M probably damaging Het
Olfr654 T G 7: 104,587,890 S46A probably benign Het
Olfr799 A G 10: 129,648,091 probably null Het
Pde3b G A 7: 114,521,692 G684D probably damaging Het
Prkaa1 C T 15: 5,174,342 T244I probably benign Het
Scfd2 A T 5: 74,206,398 probably null Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Smg1 A T 7: 118,145,590 V3113D possibly damaging Het
Sorbs1 T C 19: 40,376,881 T153A probably benign Het
Spag16 A G 1: 69,870,289 T182A probably benign Het
Svs2 T C 2: 164,237,669 K106R possibly damaging Het
Tenm1 A G X: 43,074,695 V107A possibly damaging Het
Topaz1 A T 9: 122,799,485 I1546F possibly damaging Het
Tubgcp2 C A 7: 140,032,225 E78* probably null Het
Vars A G 17: 35,005,481 probably null Het
Vmn2r109 A T 17: 20,554,305 W263R probably benign Het
Other mutations in Atf4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01348:Atf4 APN 15 80256527 unclassified probably benign
IGL03001:Atf4 APN 15 80256657 missense probably damaging 1.00
R0589:Atf4 UTSW 15 80256439 missense probably damaging 1.00
R1758:Atf4 UTSW 15 80257213 missense probably benign
R3982:Atf4 UTSW 15 80256868 missense probably benign 0.06
R4700:Atf4 UTSW 15 80257417 missense probably damaging 1.00
R4701:Atf4 UTSW 15 80257417 missense probably damaging 1.00
R4941:Atf4 UTSW 15 80256233 unclassified probably benign
R6086:Atf4 UTSW 15 80257453 missense probably benign 0.14
R7147:Atf4 UTSW 15 80257299 unclassified probably benign
R7149:Atf4 UTSW 15 80257299 unclassified probably benign
X0063:Atf4 UTSW 15 80256885 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CTTCTGGGATTTGGCCATCC -3'
(R):5'- GATCCATATGAAAAGGGCACAC -3'

Sequencing Primer
(F):5'- CCATCCGGCATCTTAGATAGAAAG -3'
(R):5'- ACCCTTGCCGGTGTCTGAG -3'
Posted On2017-01-03