Incidental Mutation 'R5706:Vmn2r109'
ID 451994
Institutional Source Beutler Lab
Gene Symbol Vmn2r109
Ensembl Gene ENSMUSG00000090572
Gene Name vomeronasal 2, receptor 109
Synonyms EG627814
MMRRC Submission 043331-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.062) question?
Stock # R5706 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 20760779-20785018 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 20774567 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Arginine at position 263 (W263R)
Ref Sequence ENSEMBL: ENSMUSP00000132641 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167093]
AlphaFold K7N747
Predicted Effect probably benign
Transcript: ENSMUST00000167093
AA Change: W263R

PolyPhen 2 Score 0.160 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000132641
Gene: ENSMUSG00000090572
AA Change: W263R

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 83 467 1.4e-35 PFAM
Pfam:NCD3G 510 563 3.1e-21 PFAM
Pfam:7tm_3 596 831 7.4e-52 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T A 3: 121,847,910 (GRCm39) M77K probably benign Het
Amy1 A G 3: 113,349,769 (GRCm39) V467A probably damaging Het
Atf4 T C 15: 80,140,531 (GRCm39) V11A possibly damaging Het
B4galt1 T C 4: 40,807,268 (GRCm39) N373D probably damaging Het
Bpifa3 A G 2: 153,977,498 (GRCm39) K112R probably damaging Het
Chd2 T A 7: 73,141,105 (GRCm39) Y596F possibly damaging Het
Clspn T C 4: 126,472,211 (GRCm39) S962P probably damaging Het
Cyp2c68 T C 19: 39,722,762 (GRCm39) D262G possibly damaging Het
Dcaf11 T C 14: 55,803,152 (GRCm39) I282T probably damaging Het
Dmxl1 T C 18: 50,090,462 (GRCm39) probably null Het
Dnah11 T G 12: 117,987,670 (GRCm39) K2411Q probably damaging Het
Elf3 A G 1: 135,184,220 (GRCm39) V196A probably benign Het
Fhad1 T G 4: 141,681,427 (GRCm39) T538P probably damaging Het
Fkbp10 A G 11: 100,311,849 (GRCm39) D174G probably damaging Het
Gas6 A G 8: 13,527,098 (GRCm39) S217P probably damaging Het
Heatr5b C T 17: 79,074,304 (GRCm39) probably null Het
Iqgap3 A G 3: 88,023,215 (GRCm39) E502G probably benign Het
Klc1 T C 12: 111,762,061 (GRCm39) V577A possibly damaging Het
Lck T C 4: 129,445,431 (GRCm39) probably null Het
Mc3r C A 2: 172,091,610 (GRCm39) Y277* probably null Het
Mlxipl T C 5: 135,162,458 (GRCm39) V640A probably benign Het
Mrc2 A T 11: 105,223,169 (GRCm39) N471Y probably damaging Het
Ncan T A 8: 70,554,667 (GRCm39) H1050L probably damaging Het
Nrl C A 14: 55,759,889 (GRCm39) V13F probably damaging Het
Obscn T A 11: 58,967,082 (GRCm39) Y546F probably damaging Het
Or52u1 T G 7: 104,237,097 (GRCm39) S46A probably benign Het
Or6c209 A G 10: 129,483,960 (GRCm39) probably null Het
Or6d14 A G 6: 116,534,074 (GRCm39) I229M probably damaging Het
Pde3b G A 7: 114,120,927 (GRCm39) G684D probably damaging Het
Prkaa1 C T 15: 5,203,823 (GRCm39) T244I probably benign Het
Scfd2 A T 5: 74,367,059 (GRCm39) probably null Het
Slc22a30 G A 19: 8,321,757 (GRCm39) Q436* probably null Het
Smg1 A T 7: 117,744,813 (GRCm39) V3113D possibly damaging Het
Sorbs1 T C 19: 40,365,325 (GRCm39) T153A probably benign Het
Spag16 A G 1: 69,909,448 (GRCm39) T182A probably benign Het
Spopfm1 T A 3: 94,173,959 (GRCm39) H322Q possibly damaging Het
Svs5 T C 2: 164,079,589 (GRCm39) K106R possibly damaging Het
Tenm1 A G X: 42,163,572 (GRCm39) V107A possibly damaging Het
Topaz1 A T 9: 122,628,550 (GRCm39) I1546F possibly damaging Het
Tubgcp2 C A 7: 139,612,138 (GRCm39) E78* probably null Het
Vars1 A G 17: 35,224,457 (GRCm39) probably null Het
Other mutations in Vmn2r109
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01313:Vmn2r109 APN 17 20,770,419 (GRCm39) missense probably damaging 1.00
IGL01383:Vmn2r109 APN 17 20,761,383 (GRCm39) missense possibly damaging 0.89
IGL01469:Vmn2r109 APN 17 20,761,671 (GRCm39) missense probably damaging 1.00
IGL01762:Vmn2r109 APN 17 20,774,654 (GRCm39) missense probably benign
IGL01864:Vmn2r109 APN 17 20,761,396 (GRCm39) missense probably benign 0.28
IGL02028:Vmn2r109 APN 17 20,761,342 (GRCm39) missense probably benign 0.28
IGL02074:Vmn2r109 APN 17 20,774,603 (GRCm39) missense probably benign 0.05
IGL02162:Vmn2r109 APN 17 20,774,422 (GRCm39) missense probably benign 0.01
IGL02474:Vmn2r109 APN 17 20,761,150 (GRCm39) missense probably benign
IGL02490:Vmn2r109 APN 17 20,761,246 (GRCm39) missense possibly damaging 0.78
IGL02604:Vmn2r109 APN 17 20,760,963 (GRCm39) missense probably damaging 1.00
IGL02669:Vmn2r109 APN 17 20,774,518 (GRCm39) missense possibly damaging 0.64
IGL02705:Vmn2r109 APN 17 20,774,062 (GRCm39) missense probably benign
IGL02745:Vmn2r109 APN 17 20,761,512 (GRCm39) missense probably damaging 0.99
PIT4142001:Vmn2r109 UTSW 17 20,774,839 (GRCm39) critical splice acceptor site probably null
R0389:Vmn2r109 UTSW 17 20,761,336 (GRCm39) missense probably damaging 1.00
R0470:Vmn2r109 UTSW 17 20,773,148 (GRCm39) missense probably benign 0.06
R0570:Vmn2r109 UTSW 17 20,760,937 (GRCm39) missense probably damaging 0.99
R0855:Vmn2r109 UTSW 17 20,761,670 (GRCm39) nonsense probably null
R0882:Vmn2r109 UTSW 17 20,774,842 (GRCm39) splice site probably benign
R1241:Vmn2r109 UTSW 17 20,775,503 (GRCm39) missense possibly damaging 0.86
R1587:Vmn2r109 UTSW 17 20,761,002 (GRCm39) missense probably damaging 1.00
R1931:Vmn2r109 UTSW 17 20,774,072 (GRCm39) nonsense probably null
R1957:Vmn2r109 UTSW 17 20,784,969 (GRCm39) missense probably benign 0.11
R1962:Vmn2r109 UTSW 17 20,774,185 (GRCm39) missense probably damaging 0.99
R2020:Vmn2r109 UTSW 17 20,761,448 (GRCm39) nonsense probably null
R2073:Vmn2r109 UTSW 17 20,784,974 (GRCm39) missense probably benign 0.00
R2436:Vmn2r109 UTSW 17 20,774,798 (GRCm39) missense probably damaging 0.99
R3123:Vmn2r109 UTSW 17 20,761,248 (GRCm39) missense probably damaging 1.00
R3839:Vmn2r109 UTSW 17 20,774,704 (GRCm39) missense probably damaging 1.00
R4019:Vmn2r109 UTSW 17 20,774,074 (GRCm39) missense probably benign
R4428:Vmn2r109 UTSW 17 20,773,286 (GRCm39) missense probably benign
R4584:Vmn2r109 UTSW 17 20,774,820 (GRCm39) nonsense probably null
R4652:Vmn2r109 UTSW 17 20,761,656 (GRCm39) missense probably damaging 1.00
R4708:Vmn2r109 UTSW 17 20,761,605 (GRCm39) missense probably damaging 0.97
R4823:Vmn2r109 UTSW 17 20,774,153 (GRCm39) missense probably damaging 1.00
R4831:Vmn2r109 UTSW 17 20,761,494 (GRCm39) missense probably benign 0.01
R4907:Vmn2r109 UTSW 17 20,770,348 (GRCm39) missense probably damaging 1.00
R5011:Vmn2r109 UTSW 17 20,775,451 (GRCm39) missense probably damaging 1.00
R5296:Vmn2r109 UTSW 17 20,774,603 (GRCm39) missense possibly damaging 0.90
R5600:Vmn2r109 UTSW 17 20,761,189 (GRCm39) missense probably damaging 1.00
R5602:Vmn2r109 UTSW 17 20,760,933 (GRCm39) missense possibly damaging 0.94
R5652:Vmn2r109 UTSW 17 20,760,781 (GRCm39) makesense probably null
R5702:Vmn2r109 UTSW 17 20,774,407 (GRCm39) missense probably benign 0.42
R5714:Vmn2r109 UTSW 17 20,773,121 (GRCm39) missense probably damaging 1.00
R5832:Vmn2r109 UTSW 17 20,761,318 (GRCm39) missense probably benign 0.10
R6008:Vmn2r109 UTSW 17 20,760,981 (GRCm39) missense probably damaging 1.00
R6334:Vmn2r109 UTSW 17 20,761,440 (GRCm39) missense probably benign 0.18
R6377:Vmn2r109 UTSW 17 20,784,796 (GRCm39) critical splice donor site probably null
R6738:Vmn2r109 UTSW 17 20,774,785 (GRCm39) missense possibly damaging 0.52
R6857:Vmn2r109 UTSW 17 20,760,932 (GRCm39) missense probably benign 0.45
R6953:Vmn2r109 UTSW 17 20,760,973 (GRCm39) missense possibly damaging 0.95
R7108:Vmn2r109 UTSW 17 20,785,006 (GRCm39) missense probably benign 0.03
R7229:Vmn2r109 UTSW 17 20,761,225 (GRCm39) missense possibly damaging 0.80
R7238:Vmn2r109 UTSW 17 20,761,336 (GRCm39) missense probably damaging 1.00
R7244:Vmn2r109 UTSW 17 20,760,945 (GRCm39) missense possibly damaging 0.70
R7292:Vmn2r109 UTSW 17 20,761,700 (GRCm39) missense probably benign 0.05
R7354:Vmn2r109 UTSW 17 20,761,043 (GRCm39) missense probably damaging 1.00
R7357:Vmn2r109 UTSW 17 20,761,536 (GRCm39) missense probably damaging 1.00
R7522:Vmn2r109 UTSW 17 20,774,665 (GRCm39) missense probably benign 0.11
R7596:Vmn2r109 UTSW 17 20,760,942 (GRCm39) missense probably damaging 0.98
R7728:Vmn2r109 UTSW 17 20,773,117 (GRCm39) missense probably damaging 0.99
R7859:Vmn2r109 UTSW 17 20,761,436 (GRCm39) missense probably damaging 1.00
R7871:Vmn2r109 UTSW 17 20,760,782 (GRCm39) missense probably benign 0.08
R8113:Vmn2r109 UTSW 17 20,774,729 (GRCm39) missense probably benign 0.01
R8153:Vmn2r109 UTSW 17 20,784,969 (GRCm39) missense probably benign 0.11
R8977:Vmn2r109 UTSW 17 20,774,531 (GRCm39) missense possibly damaging 0.96
R9687:Vmn2r109 UTSW 17 20,775,332 (GRCm39) missense
Z1176:Vmn2r109 UTSW 17 20,773,256 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCTACCATGGAATGAGTCAAACATG -3'
(R):5'- ATTCTTCGCTCTACCAGATGG -3'

Sequencing Primer
(F):5'- CAGACTTTCCCTGTCAACA -3'
(R):5'- CAAGTACACATTAATTCCACTTGGC -3'
Posted On 2017-01-03