Incidental Mutation 'R5706:Vars1'
ID 451995
Institutional Source Beutler Lab
Gene Symbol Vars1
Ensembl Gene ENSMUSG00000007029
Gene Name valyl-tRNA synthetase 1
Synonyms Bat6, Vars2, G7a, Bat-6, D17H6S56E, Vars
MMRRC Submission 043331-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.963) question?
Stock # R5706 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 35219963-35235298 bp(+) (GRCm39)
Type of Mutation splice site (679 bp from exon)
DNA Base Change (assembly) A to G at 35224457 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000134313 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087315] [ENSMUST00000172570] [ENSMUST00000173584] [ENSMUST00000174260]
AlphaFold Q9Z1Q9
Predicted Effect probably benign
Transcript: ENSMUST00000087315
AA Change: S326G

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000084572
Gene: ENSMUSG00000007029
AA Change: S326G

DomainStartEndE-ValueType
Pfam:GST_N 2 81 5.7e-16 PFAM
Pfam:GST_C 107 198 7.3e-13 PFAM
low complexity region 234 256 N/A INTRINSIC
low complexity region 261 271 N/A INTRINSIC
Pfam:tRNA-synt_1 307 938 2e-197 PFAM
Pfam:tRNA-synt_1g 336 496 6e-6 PFAM
Pfam:tRNA-synt_1_2 555 623 1.9e-11 PFAM
Pfam:Anticodon_1 983 1138 2.6e-34 PFAM
low complexity region 1153 1174 N/A INTRINSIC
low complexity region 1207 1225 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000172570
SMART Domains Protein: ENSMUSP00000134245
Gene: ENSMUSG00000007029

DomainStartEndE-ValueType
Pfam:GST_C 2 76 1.2e-13 PFAM
low complexity region 112 124 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172637
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172656
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172741
Predicted Effect probably benign
Transcript: ENSMUST00000173584
AA Change: S326G

PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000133994
Gene: ENSMUSG00000007029
AA Change: S326G

DomainStartEndE-ValueType
low complexity region 25 38 N/A INTRINSIC
low complexity region 44 58 N/A INTRINSIC
low complexity region 78 89 N/A INTRINSIC
Pfam:GST_C 96 198 7.8e-14 PFAM
low complexity region 234 256 N/A INTRINSIC
low complexity region 261 271 N/A INTRINSIC
Pfam:tRNA-synt_1 307 938 1.9e-200 PFAM
Pfam:tRNA-synt_1g 336 493 2.1e-7 PFAM
Pfam:tRNA-synt_1_2 555 623 1.1e-12 PFAM
Pfam:Anticodon_1 983 1138 7.2e-36 PFAM
low complexity region 1153 1174 N/A INTRINSIC
coiled coil region 1197 1225 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000174260
SMART Domains Protein: ENSMUSP00000134313
Gene: ENSMUSG00000007029

DomainStartEndE-ValueType
Pfam:GST_N 2 81 2.2e-16 PFAM
Pfam:GST_C 96 198 2.1e-13 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Aminoacyl-tRNA synthetases catalyze the aminoacylation of tRNA by their cognate amino acid. Because of their central role in linking amino acids with nucleotide triplets contained in tRNAs, aminoacyl-tRNA synthetases are thought to be among the first proteins that appeared in evolution. The protein encoded by this gene belongs to class-I aminoacyl-tRNA synthetase family and is located in the class III region of the major histocompatibility complex. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T A 3: 121,847,910 (GRCm39) M77K probably benign Het
Amy1 A G 3: 113,349,769 (GRCm39) V467A probably damaging Het
Atf4 T C 15: 80,140,531 (GRCm39) V11A possibly damaging Het
B4galt1 T C 4: 40,807,268 (GRCm39) N373D probably damaging Het
Bpifa3 A G 2: 153,977,498 (GRCm39) K112R probably damaging Het
Chd2 T A 7: 73,141,105 (GRCm39) Y596F possibly damaging Het
Clspn T C 4: 126,472,211 (GRCm39) S962P probably damaging Het
Cyp2c68 T C 19: 39,722,762 (GRCm39) D262G possibly damaging Het
Dcaf11 T C 14: 55,803,152 (GRCm39) I282T probably damaging Het
Dmxl1 T C 18: 50,090,462 (GRCm39) probably null Het
Dnah11 T G 12: 117,987,670 (GRCm39) K2411Q probably damaging Het
Elf3 A G 1: 135,184,220 (GRCm39) V196A probably benign Het
Fhad1 T G 4: 141,681,427 (GRCm39) T538P probably damaging Het
Fkbp10 A G 11: 100,311,849 (GRCm39) D174G probably damaging Het
Gas6 A G 8: 13,527,098 (GRCm39) S217P probably damaging Het
Heatr5b C T 17: 79,074,304 (GRCm39) probably null Het
Iqgap3 A G 3: 88,023,215 (GRCm39) E502G probably benign Het
Klc1 T C 12: 111,762,061 (GRCm39) V577A possibly damaging Het
Lck T C 4: 129,445,431 (GRCm39) probably null Het
Mc3r C A 2: 172,091,610 (GRCm39) Y277* probably null Het
Mlxipl T C 5: 135,162,458 (GRCm39) V640A probably benign Het
Mrc2 A T 11: 105,223,169 (GRCm39) N471Y probably damaging Het
Ncan T A 8: 70,554,667 (GRCm39) H1050L probably damaging Het
Nrl C A 14: 55,759,889 (GRCm39) V13F probably damaging Het
Obscn T A 11: 58,967,082 (GRCm39) Y546F probably damaging Het
Or52u1 T G 7: 104,237,097 (GRCm39) S46A probably benign Het
Or6c209 A G 10: 129,483,960 (GRCm39) probably null Het
Or6d14 A G 6: 116,534,074 (GRCm39) I229M probably damaging Het
Pde3b G A 7: 114,120,927 (GRCm39) G684D probably damaging Het
Prkaa1 C T 15: 5,203,823 (GRCm39) T244I probably benign Het
Scfd2 A T 5: 74,367,059 (GRCm39) probably null Het
Slc22a30 G A 19: 8,321,757 (GRCm39) Q436* probably null Het
Smg1 A T 7: 117,744,813 (GRCm39) V3113D possibly damaging Het
Sorbs1 T C 19: 40,365,325 (GRCm39) T153A probably benign Het
Spag16 A G 1: 69,909,448 (GRCm39) T182A probably benign Het
Spopfm1 T A 3: 94,173,959 (GRCm39) H322Q possibly damaging Het
Svs5 T C 2: 164,079,589 (GRCm39) K106R possibly damaging Het
Tenm1 A G X: 42,163,572 (GRCm39) V107A possibly damaging Het
Topaz1 A T 9: 122,628,550 (GRCm39) I1546F possibly damaging Het
Tubgcp2 C A 7: 139,612,138 (GRCm39) E78* probably null Het
Vmn2r109 A T 17: 20,774,567 (GRCm39) W263R probably benign Het
Other mutations in Vars1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01520:Vars1 APN 17 35,232,849 (GRCm39) missense probably benign 0.00
IGL02160:Vars1 APN 17 35,220,478 (GRCm39) missense probably damaging 1.00
IGL02303:Vars1 APN 17 35,234,460 (GRCm39) splice site probably benign
IGL03027:Vars1 APN 17 35,232,663 (GRCm39) missense probably damaging 1.00
Maladroit UTSW 17 35,224,451 (GRCm39) missense probably benign 0.30
Whoops UTSW 17 35,232,620 (GRCm39) missense probably damaging 1.00
FR4304:Vars1 UTSW 17 35,234,965 (GRCm39) small insertion probably benign
FR4548:Vars1 UTSW 17 35,234,967 (GRCm39) small insertion probably benign
FR4548:Vars1 UTSW 17 35,234,965 (GRCm39) small insertion probably benign
FR4589:Vars1 UTSW 17 35,234,964 (GRCm39) small insertion probably benign
R0045:Vars1 UTSW 17 35,229,595 (GRCm39) missense probably damaging 1.00
R0045:Vars1 UTSW 17 35,229,595 (GRCm39) missense probably damaging 1.00
R0045:Vars1 UTSW 17 35,217,042 (GRCm39) missense probably benign 0.13
R0266:Vars1 UTSW 17 35,232,845 (GRCm39) missense probably benign 0.00
R0267:Vars1 UTSW 17 35,230,572 (GRCm39) splice site probably benign
R0391:Vars1 UTSW 17 35,230,462 (GRCm39) missense possibly damaging 0.79
R0445:Vars1 UTSW 17 35,230,785 (GRCm39) missense probably benign 0.31
R0449:Vars1 UTSW 17 35,231,703 (GRCm39) splice site probably null
R0557:Vars1 UTSW 17 35,223,960 (GRCm39) missense possibly damaging 0.90
R0559:Vars1 UTSW 17 35,233,034 (GRCm39) nonsense probably null
R0730:Vars1 UTSW 17 35,233,276 (GRCm39) missense probably damaging 1.00
R0748:Vars1 UTSW 17 35,216,988 (GRCm39) missense probably damaging 1.00
R1692:Vars1 UTSW 17 35,232,701 (GRCm39) missense probably damaging 1.00
R1693:Vars1 UTSW 17 35,217,172 (GRCm39) missense probably benign 0.31
R1697:Vars1 UTSW 17 35,217,198 (GRCm39) missense probably benign 0.43
R1699:Vars1 UTSW 17 35,233,734 (GRCm39) missense possibly damaging 0.93
R1712:Vars1 UTSW 17 35,233,728 (GRCm39) missense probably damaging 1.00
R1989:Vars1 UTSW 17 35,230,814 (GRCm39) missense possibly damaging 0.94
R2349:Vars1 UTSW 17 35,234,728 (GRCm39) missense probably benign
R2365:Vars1 UTSW 17 35,234,428 (GRCm39) missense probably benign 0.01
R3790:Vars1 UTSW 17 35,218,310 (GRCm39) missense probably benign 0.34
R4615:Vars1 UTSW 17 35,232,857 (GRCm39) missense probably damaging 0.97
R4844:Vars1 UTSW 17 35,230,588 (GRCm39) missense probably damaging 1.00
R4856:Vars1 UTSW 17 35,234,702 (GRCm39) missense probably benign 0.37
R4886:Vars1 UTSW 17 35,234,702 (GRCm39) missense probably benign 0.37
R5570:Vars1 UTSW 17 35,235,214 (GRCm39) missense probably benign 0.04
R5858:Vars1 UTSW 17 35,224,451 (GRCm39) missense probably benign 0.30
R5907:Vars1 UTSW 17 35,231,352 (GRCm39) missense probably damaging 1.00
R5917:Vars1 UTSW 17 35,231,491 (GRCm39) missense probably damaging 0.99
R5944:Vars1 UTSW 17 35,232,620 (GRCm39) missense probably damaging 1.00
R6023:Vars1 UTSW 17 35,220,585 (GRCm39) missense probably damaging 1.00
R6073:Vars1 UTSW 17 35,220,505 (GRCm39) missense probably benign
R6273:Vars1 UTSW 17 35,232,719 (GRCm39) missense probably damaging 1.00
R6390:Vars1 UTSW 17 35,234,615 (GRCm39) missense probably benign 0.00
R6658:Vars1 UTSW 17 35,234,717 (GRCm39) missense probably benign 0.03
R7067:Vars1 UTSW 17 35,230,455 (GRCm39) missense probably damaging 0.98
R7387:Vars1 UTSW 17 35,223,768 (GRCm39) nonsense probably null
R7954:Vars1 UTSW 17 35,234,960 (GRCm39) missense probably benign 0.01
R8139:Vars1 UTSW 17 35,230,480 (GRCm39) missense probably benign 0.16
R8347:Vars1 UTSW 17 35,234,953 (GRCm39) missense possibly damaging 0.92
R8387:Vars1 UTSW 17 35,229,490 (GRCm39) missense probably damaging 0.99
R8855:Vars1 UTSW 17 35,234,620 (GRCm39) missense probably benign 0.00
R8866:Vars1 UTSW 17 35,234,620 (GRCm39) missense probably benign 0.00
R9131:Vars1 UTSW 17 35,223,773 (GRCm39) missense possibly damaging 0.77
R9620:Vars1 UTSW 17 35,235,001 (GRCm39) missense unknown
R9695:Vars1 UTSW 17 35,231,564 (GRCm39) missense possibly damaging 0.82
Z1177:Vars1 UTSW 17 35,230,453 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGCCCTCAGTATGTGGAG -3'
(R):5'- GCCTCGCTGACAGATTACTTG -3'

Sequencing Primer
(F):5'- AGGCTGCCTGGTATCCATG -3'
(R):5'- CTCGCTGACAGATTACTTGAACAGG -3'
Posted On 2017-01-03