Mutagenetix > Incidental Mutations

Incidental Mutation 'R5706:Cyp2c68'

451999

Institutional Source

Beutler Lab

Gene Symbol

Cyp2c68

Ensembl Gene

ENSMUSG00000074882

Gene Name

cytochrome P450, family 2, subfamily c, polypeptide 68

Synonyms

9030012A22Rik

MMRRC Submission

043331-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5706 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

39688834-39741054 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 39734318 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 262 (D262G)

Ref Sequence

ENSEMBL: ENSMUSP00000097071 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099472]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000099472
AA Change: D262G

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000097071
Gene: ENSMUSG00000074882
AA Change: D262G

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Pfam:p450	30	487	2.1e-150	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 95.1%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca4	T	A	3: 122,054,261	M77K	probably benign	Het
Amy1	A	G	3: 113,556,120	V467A	probably damaging	Het
Atf4	T	C	15: 80,256,330	V11A	possibly damaging	Het
B4galt1	T	C	4: 40,807,268	N373D	probably damaging	Het
Bpifa3	A	G	2: 154,135,578	K112R	probably damaging	Het
Chd2	T	A	7: 73,491,357	Y596F	possibly damaging	Het
Clspn	T	C	4: 126,578,418	S962P	probably damaging	Het
Dcaf11	T	C	14: 55,565,695	I282T	probably damaging	Het
Dmxl1	T	C	18: 49,957,395		probably null	Het
Dnah11	T	G	12: 118,023,935	K2411Q	probably damaging	Het
Elf3	A	G	1: 135,256,482	V196A	probably benign	Het
Fhad1	T	G	4: 141,954,116	T538P	probably damaging	Het
Fkbp10	A	G	11: 100,421,023	D174G	probably damaging	Het
Gas6	A	G	8: 13,477,098	S217P	probably damaging	Het
Gm4778	T	A	3: 94,266,652	H322Q	possibly damaging	Het
Heatr5b	C	T	17: 78,766,875		probably null	Het
Iqgap3	A	G	3: 88,115,908	E502G	probably benign	Het
Klc1	T	C	12: 111,795,627	V577A	possibly damaging	Het
Lck	T	C	4: 129,551,638		probably null	Het
Mc3r	C	A	2: 172,249,690	Y277*	probably null	Het
Mlxipl	T	C	5: 135,133,604	V640A	probably benign	Het
Mrc2	A	T	11: 105,332,343	N471Y	probably damaging	Het
Ncan	T	A	8: 70,102,017	H1050L	probably damaging	Het
Nrl	C	A	14: 55,522,432	V13F	probably damaging	Het
Obscn	T	A	11: 59,076,256	Y546F	probably damaging	Het
Olfr214	A	G	6: 116,557,113	I229M	probably damaging	Het
Olfr654	T	G	7: 104,587,890	S46A	probably benign	Het
Olfr799	A	G	10: 129,648,091		probably null	Het
Pde3b	G	A	7: 114,521,692	G684D	probably damaging	Het
Prkaa1	C	T	15: 5,174,342	T244I	probably benign	Het
Scfd2	A	T	5: 74,206,398		probably null	Het
Slc22a30	G	A	19: 8,344,393	Q436*	probably null	Het
Smg1	A	T	7: 118,145,590	V3113D	possibly damaging	Het
Sorbs1	T	C	19: 40,376,881	T153A	probably benign	Het
Spag16	A	G	1: 69,870,289	T182A	probably benign	Het
Svs2	T	C	2: 164,237,669	K106R	possibly damaging	Het
Tenm1	A	G	X: 43,074,695	V107A	possibly damaging	Het
Topaz1	A	T	9: 122,799,485	I1546F	possibly damaging	Het
Tubgcp2	C	A	7: 140,032,225	E78*	probably null	Het
Vars	A	G	17: 35,005,481		probably null	Het
Vmn2r109	A	T	17: 20,554,305	W263R	probably benign	Het

Other mutations in Cyp2c68

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00514:Cyp2c68	APN	19	39712495	missense	probably damaging	0.98
IGL00826:Cyp2c68	APN	19	39739505	missense	possibly damaging	0.87
IGL01363:Cyp2c68	APN	19	39703427	missense	probably benign	0.01
IGL01892:Cyp2c68	APN	19	39734344	missense	probably benign	0.00
IGL02088:Cyp2c68	APN	19	39703521	splice site	probably benign
IGL02422:Cyp2c68	APN	19	39734452	missense	probably damaging	1.00
IGL03047:Cyp2c68	UTSW	19	39734460	missense	probably benign	0.00
R0523:Cyp2c68	UTSW	19	39739429	missense	probably benign	0.08
R0729:Cyp2c68	UTSW	19	39739550	splice site	probably benign
R0975:Cyp2c68	UTSW	19	39703358	missense	possibly damaging	0.85
R1117:Cyp2c68	UTSW	19	39712459	missense	probably damaging	1.00
R1355:Cyp2c68	UTSW	19	39740956	missense	probably damaging	1.00
R1370:Cyp2c68	UTSW	19	39740956	missense	probably damaging	1.00
R1436:Cyp2c68	UTSW	19	39741040	start codon destroyed	probably null	1.00
R1564:Cyp2c68	UTSW	19	39735580	nonsense	probably null
R1730:Cyp2c68	UTSW	19	39699275	missense	possibly damaging	0.87
R1865:Cyp2c68	UTSW	19	39734289	missense	probably benign	0.04
R1905:Cyp2c68	UTSW	19	39735582	missense	probably benign	0.01
R1951:Cyp2c68	UTSW	19	39712528	missense	probably benign	0.22
R1952:Cyp2c68	UTSW	19	39712528	missense	probably benign	0.22
R2224:Cyp2c68	UTSW	19	39735582	missense	probably benign	0.34
R2230:Cyp2c68	UTSW	19	39699360	missense	probably benign	0.07
R2231:Cyp2c68	UTSW	19	39699360	missense	probably benign	0.07
R2866:Cyp2c68	UTSW	19	39689145	missense	probably damaging	1.00
R3104:Cyp2c68	UTSW	19	39734313	missense	probably benign
R4409:Cyp2c68	UTSW	19	39739452	missense	probably damaging	0.98
R4575:Cyp2c68	UTSW	19	39734361	missense	probably benign	0.21
R4620:Cyp2c68	UTSW	19	39712562	splice site	probably null
R4684:Cyp2c68	UTSW	19	39699335	missense	possibly damaging	0.48
R5023:Cyp2c68	UTSW	19	39712507	missense	probably benign	0.01
R5410:Cyp2c68	UTSW	19	39699284	missense	possibly damaging	0.65
R5513:Cyp2c68	UTSW	19	39703406	missense	probably damaging	1.00
R5568:Cyp2c68	UTSW	19	39689082	missense	probably benign	0.19
R5890:Cyp2c68	UTSW	19	39712492	missense	probably damaging	1.00
R5897:Cyp2c68	UTSW	19	39712531	missense	probably benign	0.01
R6007:Cyp2c68	UTSW	19	39734336	missense	probably damaging	1.00
R6132:Cyp2c68	UTSW	19	39703414	missense	possibly damaging	0.90
R6187:Cyp2c68	UTSW	19	39741008	missense	probably benign	0.32
R6229:Cyp2c68	UTSW	19	39739178	missense	probably benign	0.02
R6341:Cyp2c68	UTSW	19	39712489	missense	possibly damaging	0.54
R7209:Cyp2c68	UTSW	19	39689205	missense	probably damaging	1.00
R7330:Cyp2c68	UTSW	19	39689190	missense	probably damaging	1.00
R7374:Cyp2c68	UTSW	19	39739204	critical splice acceptor site	probably null
R7402:Cyp2c68	UTSW	19	39740874	missense	probably benign	0.02
R7483:Cyp2c68	UTSW	19	39689137	missense	probably benign	0.02
Z1088:Cyp2c68	UTSW	19	39739463	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- AAAATCACCCTGCTTCTCTCAG -3'
(R):5'- CACTCAAAAGATATGTGAGTGTGG -3'

Sequencing Primer
(F):5'- TCTCAGCCATTCCCACACATG -3'
(R):5'- TTGCAGAAATTTGTTCAACCAATC -3'

Posted On

2017-01-03