Incidental Mutation 'R0551:Tiam2'
ID45200
Institutional Source Beutler Lab
Gene Symbol Tiam2
Ensembl Gene ENSMUSG00000023800
Gene NameT cell lymphoma invasion and metastasis 2
Synonyms3000002F19Rik, STEF
MMRRC Submission 038743-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0551 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location3326573-3531344 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 3428954 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 654 (M654K)
Ref Sequence ENSEMBL: ENSMUSP00000125842 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072156] [ENSMUST00000169838]
Predicted Effect probably damaging
Transcript: ENSMUST00000072156
AA Change: M654K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000072020
Gene: ENSMUSG00000023800
AA Change: M654K

DomainStartEndE-ValueType
low complexity region 230 245 N/A INTRINSIC
low complexity region 267 281 N/A INTRINSIC
low complexity region 471 492 N/A INTRINSIC
PH 505 620 7.82e-16 SMART
RBD 831 902 1.32e-26 SMART
PDZ 921 995 2.38e-7 SMART
RhoGEF 1124 1313 2.23e-61 SMART
PH 1347 1478 2.86e0 SMART
low complexity region 1522 1532 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169838
AA Change: M654K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125842
Gene: ENSMUSG00000023800
AA Change: M654K

DomainStartEndE-ValueType
low complexity region 230 245 N/A INTRINSIC
low complexity region 267 281 N/A INTRINSIC
low complexity region 471 492 N/A INTRINSIC
PH 505 620 7.82e-16 SMART
RBD 831 902 1.32e-26 SMART
PDZ 921 995 2.38e-7 SMART
RhoGEF 1124 1313 2.23e-61 SMART
PH 1347 1478 2.86e0 SMART
low complexity region 1522 1532 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226905
Meta Mutation Damage Score 0.8629 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a guanine nucleotide exchange factor. A highly similar mouse protein specifically activates ras-related C3 botulinum substrate 1, converting this Rho-like guanosine triphosphatase (GTPase) from a guanosine diphosphate-bound inactive state to a guanosine triphosphate-bound active state. The encoded protein may play a role in neural cell development. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T A 14: 32,662,641 T456S probably benign Het
5830473C10Rik C T 5: 90,572,719 P250S probably damaging Het
Acmsd A T 1: 127,766,333 K333N probably benign Het
Adcy2 T A 13: 68,796,539 K241N probably damaging Het
Aebp1 A G 11: 5,867,955 I77V probably benign Het
Ankrd35 A G 3: 96,683,960 T521A probably benign Het
Arap2 C T 5: 62,641,323 probably null Het
Arfgap3 A T 15: 83,343,137 C25S probably damaging Het
Arhgap20 T A 9: 51,825,825 probably benign Het
Arhgap39 C T 15: 76,734,886 D833N probably damaging Het
Auts2 T C 5: 131,440,469 E446G possibly damaging Het
Brwd1 C T 16: 96,035,974 R886H probably damaging Het
Carm1 G A 9: 21,580,491 probably null Het
Cdc5l G A 17: 45,415,684 R321W probably damaging Het
Cfap54 A T 10: 93,025,122 M841K probably benign Het
Clca4b T A 3: 144,928,626 T69S probably damaging Het
Cpox A G 16: 58,675,390 I357V probably benign Het
Diaph3 C A 14: 86,910,100 V711L probably benign Het
Fabp3-ps1 T C 10: 86,732,040 probably benign Het
Fam120b A T 17: 15,431,643 probably benign Het
Fcho1 A G 8: 71,712,174 S488P probably benign Het
Flcn A G 11: 59,795,748 probably null Het
Flt3l A G 7: 45,132,266 W234R probably damaging Het
Fzd7 G T 1: 59,483,284 V109L probably damaging Het
G3bp1 A G 11: 55,489,143 N101S probably benign Het
Gadd45g A G 13: 51,847,927 E143G probably damaging Het
Ganab T G 19: 8,907,280 I149S probably benign Het
Garnl3 A G 2: 33,016,738 S413P probably damaging Het
Glis1 C T 4: 107,568,119 probably null Het
Gm11563 A G 11: 99,658,713 S72P unknown Het
Gpd1 T G 15: 99,720,629 I188S possibly damaging Het
Gria2 A G 3: 80,732,026 probably benign Het
H2afy2 A G 10: 61,741,166 S308P probably damaging Het
Hpcal4 G T 4: 123,189,055 A65S possibly damaging Het
Igsf10 G A 3: 59,328,668 T1364I probably benign Het
Kdm4a T C 4: 118,138,231 *1065W probably null Het
Klkb1 A G 8: 45,277,966 probably null Het
Lipo3 T C 19: 33,580,551 D147G probably damaging Het
Lrp1 A G 10: 127,571,958 S1821P probably benign Het
Manba T C 3: 135,517,973 I207T probably damaging Het
Mark3 T A 12: 111,633,634 S428T probably benign Het
Mfsd4a G A 1: 132,041,919 T348I probably damaging Het
Mfsd7a A G 5: 108,444,465 probably benign Het
Mybbp1a A G 11: 72,448,376 M880V probably benign Het
N4bp2 T A 5: 65,820,341 probably null Het
Nrd1 T G 4: 109,047,708 I712S probably damaging Het
Nup210 G A 6: 91,021,484 R774C possibly damaging Het
Obscn G A 11: 59,107,862 R1395* probably null Het
Olfr1454 T A 19: 13,064,294 D294E probably benign Het
Pcdh7 T C 5: 57,721,994 Y964H probably damaging Het
Plin4 T C 17: 56,106,756 T290A probably benign Het
Ppara T C 15: 85,787,105 probably benign Het
Psg21 T G 7: 18,652,640 probably null Het
Ptar1 C A 19: 23,720,340 N405K probably benign Het
Ralgps2 A G 1: 156,832,663 probably null Het
Rnf6 T A 5: 146,211,395 N271I possibly damaging Het
Sis T C 3: 72,925,407 D1019G possibly damaging Het
Slc37a3 A G 6: 39,352,754 probably benign Het
Slc6a12 G A 6: 121,356,918 V238I probably damaging Het
Sntg1 C A 1: 8,554,736 V279L possibly damaging Het
Sorbs1 T A 19: 40,311,816 E567D probably damaging Het
Sp110 C A 1: 85,589,100 probably benign Het
Ssu2 A G 6: 112,380,554 V175A possibly damaging Het
Stk36 G A 1: 74,616,621 E428K probably benign Het
Teddm1b A T 1: 153,875,344 I300F possibly damaging Het
Thy1 T C 9: 44,047,348 V129A probably damaging Het
Tmem69 T C 4: 116,553,273 S167G probably benign Het
Tmem8 C A 17: 26,120,602 Q605K probably damaging Het
Tmem81 C G 1: 132,507,829 I124M probably damaging Het
Tspan10 A G 11: 120,444,418 D118G probably damaging Het
Tspo2 A G 17: 48,448,813 probably benign Het
Ttn G A 2: 76,908,328 Q4002* probably null Het
Tyro3 G A 2: 119,816,904 R834Q probably damaging Het
Ugt2b1 T C 5: 86,926,084 K139E probably benign Het
Vmn1r9 A T 6: 57,071,539 I200F probably benign Het
Other mutations in Tiam2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01011:Tiam2 APN 17 3415028 missense probably benign 0.21
IGL01320:Tiam2 APN 17 3505745 missense probably damaging 1.00
IGL01384:Tiam2 APN 17 3427202 missense probably benign 0.08
IGL01575:Tiam2 APN 17 3454316 missense probably damaging 1.00
IGL01769:Tiam2 APN 17 3427290 missense probably damaging 1.00
IGL02395:Tiam2 APN 17 3421481 missense possibly damaging 0.49
IGL02652:Tiam2 APN 17 3439696 splice site probably benign
IGL03102:Tiam2 APN 17 3509548 missense probably damaging 1.00
IGL03222:Tiam2 APN 17 3438708 missense probably damaging 0.97
Feste_burg UTSW 17 3414622 frame shift probably null
R0257:Tiam2 UTSW 17 3450813 missense possibly damaging 0.49
R0420:Tiam2 UTSW 17 3502918 missense probably benign 0.01
R0528:Tiam2 UTSW 17 3511071 missense probably damaging 1.00
R0532:Tiam2 UTSW 17 3421646 missense probably damaging 1.00
R0554:Tiam2 UTSW 17 3438681 nonsense probably null
R0645:Tiam2 UTSW 17 3514698 missense possibly damaging 0.92
R0726:Tiam2 UTSW 17 3512833 unclassified probably benign
R1139:Tiam2 UTSW 17 3477267 missense possibly damaging 0.55
R1392:Tiam2 UTSW 17 3414197 missense possibly damaging 0.71
R1392:Tiam2 UTSW 17 3414197 missense possibly damaging 0.71
R1529:Tiam2 UTSW 17 3516703 missense probably benign 0.00
R1671:Tiam2 UTSW 17 3506834 missense probably damaging 1.00
R1731:Tiam2 UTSW 17 3518423 missense probably damaging 0.98
R1759:Tiam2 UTSW 17 3516003 missense probably damaging 0.98
R1850:Tiam2 UTSW 17 3437235 missense probably damaging 1.00
R1853:Tiam2 UTSW 17 3415135 missense probably damaging 1.00
R1855:Tiam2 UTSW 17 3415135 missense probably damaging 1.00
R1931:Tiam2 UTSW 17 3514725 missense possibly damaging 0.68
R1932:Tiam2 UTSW 17 3514725 missense possibly damaging 0.68
R1993:Tiam2 UTSW 17 3415126 nonsense probably null
R2211:Tiam2 UTSW 17 3414918 nonsense probably null
R2217:Tiam2 UTSW 17 3415114 missense probably benign 0.34
R2278:Tiam2 UTSW 17 3427220 missense probably damaging 0.96
R2407:Tiam2 UTSW 17 3477261 missense probably benign 0.14
R2516:Tiam2 UTSW 17 3453382 missense probably damaging 1.00
R2991:Tiam2 UTSW 17 3518250 missense probably benign
R3086:Tiam2 UTSW 17 3421582 missense probably damaging 1.00
R3121:Tiam2 UTSW 17 3439702 missense probably benign 0.01
R3686:Tiam2 UTSW 17 3421684 missense possibly damaging 0.87
R3740:Tiam2 UTSW 17 3414113 missense possibly damaging 0.54
R3742:Tiam2 UTSW 17 3414113 missense possibly damaging 0.54
R3826:Tiam2 UTSW 17 3507701 splice site probably benign
R3829:Tiam2 UTSW 17 3507701 splice site probably benign
R3844:Tiam2 UTSW 17 3421651 missense probably damaging 0.98
R3970:Tiam2 UTSW 17 3428831 missense probably damaging 1.00
R4060:Tiam2 UTSW 17 3428980 missense probably benign 0.00
R4296:Tiam2 UTSW 17 3450845 missense probably benign
R4357:Tiam2 UTSW 17 3450853 missense probably damaging 1.00
R4368:Tiam2 UTSW 17 3414683 missense probably benign 0.01
R4369:Tiam2 UTSW 17 3413967 start gained probably benign
R4524:Tiam2 UTSW 17 3514711 missense probably damaging 1.00
R4619:Tiam2 UTSW 17 3518342 missense probably damaging 1.00
R4715:Tiam2 UTSW 17 3454168 missense probably damaging 1.00
R4723:Tiam2 UTSW 17 3450317 missense probably benign 0.00
R4979:Tiam2 UTSW 17 3505710 missense probably damaging 1.00
R5182:Tiam2 UTSW 17 3438721 missense probably damaging 1.00
R5451:Tiam2 UTSW 17 3428996 missense probably damaging 1.00
R5728:Tiam2 UTSW 17 3414956 missense probably damaging 0.99
R5827:Tiam2 UTSW 17 3448489 missense probably benign 0.00
R5879:Tiam2 UTSW 17 3437265 missense probably damaging 1.00
R5960:Tiam2 UTSW 17 3438640 missense probably benign 0.24
R5974:Tiam2 UTSW 17 3414809 missense possibly damaging 0.51
R6198:Tiam2 UTSW 17 3414121 missense probably benign 0.06
R6222:Tiam2 UTSW 17 3453338 missense probably damaging 0.96
R6295:Tiam2 UTSW 17 3509556 missense probably damaging 1.00
R6355:Tiam2 UTSW 17 3414622 frame shift probably null
R6356:Tiam2 UTSW 17 3414622 frame shift probably null
R6454:Tiam2 UTSW 17 3438663 missense probably benign 0.00
R6497:Tiam2 UTSW 17 3506827 missense probably damaging 1.00
R6579:Tiam2 UTSW 17 3414622 frame shift probably null
R6580:Tiam2 UTSW 17 3414622 frame shift probably null
R6581:Tiam2 UTSW 17 3414622 frame shift probably null
R6582:Tiam2 UTSW 17 3414622 frame shift probably null
R6648:Tiam2 UTSW 17 3506873 missense probably damaging 1.00
R6705:Tiam2 UTSW 17 3518243 missense probably benign 0.01
R6758:Tiam2 UTSW 17 3518403 missense probably benign 0.01
R6836:Tiam2 UTSW 17 3414380 missense probably benign 0.17
R6924:Tiam2 UTSW 17 3507795 missense probably damaging 1.00
R6977:Tiam2 UTSW 17 3518659 missense probably damaging 1.00
R7051:Tiam2 UTSW 17 3448483 missense probably damaging 0.99
R7151:Tiam2 UTSW 17 3448385 missense probably benign 0.36
R7214:Tiam2 UTSW 17 3518412 missense possibly damaging 0.85
R7332:Tiam2 UTSW 17 3453369 missense probably damaging 1.00
R7334:Tiam2 UTSW 17 3503008 missense possibly damaging 0.92
R7414:Tiam2 UTSW 17 3414113 missense possibly damaging 0.54
R7660:Tiam2 UTSW 17 3482605 start codon destroyed probably null 0.66
R7743:Tiam2 UTSW 17 3518156 missense possibly damaging 0.53
R7755:Tiam2 UTSW 17 3421316 missense probably benign 0.01
R7805:Tiam2 UTSW 17 3509410 missense probably damaging 1.00
R7813:Tiam2 UTSW 17 3437247 missense probably damaging 1.00
R7842:Tiam2 UTSW 17 3518124 missense possibly damaging 0.82
R7925:Tiam2 UTSW 17 3518124 missense possibly damaging 0.82
R8011:Tiam2 UTSW 17 3448396 missense possibly damaging 0.92
X0027:Tiam2 UTSW 17 3414000 start codon destroyed probably null 1.00
X0060:Tiam2 UTSW 17 3450354 intron probably null
X0065:Tiam2 UTSW 17 3505708 missense probably damaging 1.00
Z1088:Tiam2 UTSW 17 3415019 missense probably benign 0.01
Z1176:Tiam2 UTSW 17 3505776 missense probably null 1.00
Z1177:Tiam2 UTSW 17 3427263 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGGAAAACTGGGTCACAGCCATC -3'
(R):5'- TCTCACAGCATTTGAAGGCTACACC -3'

Sequencing Primer
(F):5'- GGTCACAGCCATCCACTCG -3'
(R):5'- TTCAGGTCAGAACACACATCTCTTAG -3'
Posted On2013-06-11