Incidental Mutation 'R5706:Tenm1'
ID452001
Institutional Source Beutler Lab
Gene Symbol Tenm1
Ensembl Gene ENSMUSG00000016150
Gene Nameteneurin transmembrane protein 1
SynonymsTCAP-1, teneurin-1, Odz1, Ten-m1
MMRRC Submission 043331-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.378) question?
Stock #R5706 (G1)
Quality Score222
Status Not validated
ChromosomeX
Chromosomal Location42527866-43429126 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 43074695 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 107 (V107A)
Ref Sequence ENSEMBL: ENSMUSP00000110711 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016294] [ENSMUST00000115058] [ENSMUST00000115059]
Predicted Effect possibly damaging
Transcript: ENSMUST00000016294
AA Change: V107A

PolyPhen 2 Score 0.579 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000016294
Gene: ENSMUSG00000016150
AA Change: V107A

DomainStartEndE-ValueType
Pfam:Ten_N 12 177 5.1e-30 PFAM
Pfam:Ten_N 168 317 1.5e-45 PFAM
transmembrane domain 318 340 N/A INTRINSIC
EGF 530 558 8.8e-3 SMART
EGF_like 561 589 2.5e-1 SMART
EGF 594 623 1.2e-2 SMART
EGF 626 655 4.5e-3 SMART
EGF 660 690 1.1e-1 SMART
EGF 693 721 6e-2 SMART
EGF 724 752 1.5e-2 SMART
EGF 763 795 1.6e-2 SMART
low complexity region 801 816 N/A INTRINSIC
Pfam:Tox-GHH 2647 2724 5e-29 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000115058
AA Change: V107A

PolyPhen 2 Score 0.579 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000110710
Gene: ENSMUSG00000016150
AA Change: V107A

DomainStartEndE-ValueType
Pfam:Ten_N 11 170 5.4e-36 PFAM
Pfam:Ten_N 159 317 7.4e-46 PFAM
transmembrane domain 318 340 N/A INTRINSIC
EGF 530 558 1.73e0 SMART
EGF_like 561 589 5.13e1 SMART
EGF 594 623 2.45e0 SMART
EGF 626 655 9.27e-1 SMART
EGF 660 690 2.29e1 SMART
EGF 693 721 1.2e1 SMART
EGF 724 752 3.01e0 SMART
EGF 763 795 3.23e0 SMART
low complexity region 801 816 N/A INTRINSIC
Pfam:Tox-GHH 2639 2717 1.1e-33 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000115059
AA Change: V107A

PolyPhen 2 Score 0.579 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000110711
Gene: ENSMUSG00000016150
AA Change: V107A

DomainStartEndE-ValueType
Pfam:Ten_N 11 170 1.2e-32 PFAM
Pfam:Ten_N 159 317 1.6e-42 PFAM
transmembrane domain 318 340 N/A INTRINSIC
EGF 530 558 8.6e-3 SMART
EGF_like 561 589 2.5e-1 SMART
EGF 594 623 1.2e-2 SMART
EGF 626 655 4.4e-3 SMART
EGF 660 690 1.1e-1 SMART
EGF 693 721 5.8e-2 SMART
EGF 724 752 1.5e-2 SMART
EGF 763 795 1.6e-2 SMART
low complexity region 801 816 N/A INTRINSIC
Pfam:Tox-GHH 2646 2724 2.3e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126161
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154433
Meta Mutation Damage Score 0.1150 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the tenascin family and teneurin subfamily. It is expressed in the neurons and may function as a cellular signal transducer. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T A 3: 122,054,261 M77K probably benign Het
Amy1 A G 3: 113,556,120 V467A probably damaging Het
Atf4 T C 15: 80,256,330 V11A possibly damaging Het
B4galt1 T C 4: 40,807,268 N373D probably damaging Het
Bpifa3 A G 2: 154,135,578 K112R probably damaging Het
Chd2 T A 7: 73,491,357 Y596F possibly damaging Het
Clspn T C 4: 126,578,418 S962P probably damaging Het
Cyp2c68 T C 19: 39,734,318 D262G possibly damaging Het
Dcaf11 T C 14: 55,565,695 I282T probably damaging Het
Dmxl1 T C 18: 49,957,395 probably null Het
Dnah11 T G 12: 118,023,935 K2411Q probably damaging Het
Elf3 A G 1: 135,256,482 V196A probably benign Het
Fhad1 T G 4: 141,954,116 T538P probably damaging Het
Fkbp10 A G 11: 100,421,023 D174G probably damaging Het
Gas6 A G 8: 13,477,098 S217P probably damaging Het
Gm4778 T A 3: 94,266,652 H322Q possibly damaging Het
Heatr5b C T 17: 78,766,875 probably null Het
Iqgap3 A G 3: 88,115,908 E502G probably benign Het
Klc1 T C 12: 111,795,627 V577A possibly damaging Het
Lck T C 4: 129,551,638 probably null Het
Mc3r C A 2: 172,249,690 Y277* probably null Het
Mlxipl T C 5: 135,133,604 V640A probably benign Het
Mrc2 A T 11: 105,332,343 N471Y probably damaging Het
Ncan T A 8: 70,102,017 H1050L probably damaging Het
Nrl C A 14: 55,522,432 V13F probably damaging Het
Obscn T A 11: 59,076,256 Y546F probably damaging Het
Olfr214 A G 6: 116,557,113 I229M probably damaging Het
Olfr654 T G 7: 104,587,890 S46A probably benign Het
Olfr799 A G 10: 129,648,091 probably null Het
Pde3b G A 7: 114,521,692 G684D probably damaging Het
Prkaa1 C T 15: 5,174,342 T244I probably benign Het
Scfd2 A T 5: 74,206,398 probably null Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Smg1 A T 7: 118,145,590 V3113D possibly damaging Het
Sorbs1 T C 19: 40,376,881 T153A probably benign Het
Spag16 A G 1: 69,870,289 T182A probably benign Het
Svs2 T C 2: 164,237,669 K106R possibly damaging Het
Topaz1 A T 9: 122,799,485 I1546F possibly damaging Het
Tubgcp2 C A 7: 140,032,225 E78* probably null Het
Vars A G 17: 35,005,481 probably null Het
Vmn2r109 A T 17: 20,554,305 W263R probably benign Het
Other mutations in Tenm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00594:Tenm1 APN X 42715036 missense probably benign 0.04
R0481:Tenm1 UTSW X 42536181 missense probably damaging 1.00
R1959:Tenm1 UTSW X 42827201 missense probably benign 0.06
R1960:Tenm1 UTSW X 42827201 missense probably benign 0.06
R3734:Tenm1 UTSW X 42684067 missense probably benign 0.32
R4585:Tenm1 UTSW X 42537979 nonsense probably null
R5704:Tenm1 UTSW X 43074695 missense possibly damaging 0.58
R6112:Tenm1 UTSW X 42827195 missense probably damaging 1.00
R6113:Tenm1 UTSW X 42827195 missense probably damaging 1.00
X0067:Tenm1 UTSW X 42536862 missense probably damaging 1.00
Z1088:Tenm1 UTSW X 42899835 missense probably damaging 1.00
Z1176:Tenm1 UTSW X 42816803 missense probably damaging 0.96
Z1176:Tenm1 UTSW X 42816804 nonsense probably null
Z1177:Tenm1 UTSW X 42825548 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCCAATACCAGAAGTGATAGC -3'
(R):5'- TCATAATTACTAGCAATGGGGAAGG -3'

Sequencing Primer
(F):5'- AACTGCAGATGTAGTTTTCTTACC -3'
(R):5'- TTACTAGCAATGGGGAAGGGGAAAC -3'
Posted On2017-01-03