Incidental Mutation 'R5707:Phf20'
ID452007
Institutional Source Beutler Lab
Gene Symbol Phf20
Ensembl Gene ENSMUSG00000038116
Gene NamePHD finger protein 20
Synonyms
MMRRC Submission 043332-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.884) question?
Stock #R5707 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location156196466-156309952 bp(+) (GRCm38)
Type of Mutationintron (23 bp from exon)
DNA Base Change (assembly) T to G at 156296771 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000043138 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037401]
Predicted Effect probably null
Transcript: ENSMUST00000037401
SMART Domains Protein: ENSMUSP00000043138
Gene: ENSMUSG00000038116

DomainStartEndE-ValueType
TUDOR 11 71 5.27e0 SMART
TUDOR 85 141 7.13e-4 SMART
AT_hook 257 269 1.65e0 SMART
low complexity region 323 332 N/A INTRINSIC
ZnF_C2H2 455 480 1.86e0 SMART
low complexity region 486 493 N/A INTRINSIC
low complexity region 526 555 N/A INTRINSIC
low complexity region 612 630 N/A INTRINSIC
PHD 657 701 2.83e-4 SMART
coiled coil region 945 966 N/A INTRINSIC
low complexity region 974 987 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122814
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132352
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147234
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147242
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152617
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 97% (56/58)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality, decreased body size and total body fat amount, and abnormal skeletal and hematopoietic development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700125H20Rik A G 11: 85,173,312 N93S probably benign Het
9330182L06Rik A G 5: 9,441,698 Y686C probably damaging Het
Abca13 T C 11: 9,510,620 L4210P probably damaging Het
Adcy6 T C 15: 98,598,741 T518A probably damaging Het
Adgb C T 10: 10,391,757 V940I probably damaging Het
Aqp11 A G 7: 97,737,428 V187A possibly damaging Het
Arhgef15 A G 11: 68,954,715 S104P probably damaging Het
BC027072 G T 17: 71,751,572 A370E possibly damaging Het
Birc6 T A 17: 74,696,404 N4762K probably damaging Het
Cacna1e T C 1: 154,633,717 D264G probably damaging Het
Cela3b G T 4: 137,424,856 Q97K probably damaging Het
Cenpc1 T A 5: 86,035,434 R499W possibly damaging Het
Cnr1 C A 4: 33,944,330 C239* probably null Het
Col6a2 T C 10: 76,611,031 K348E possibly damaging Het
Ctnnb1 C A 9: 120,955,168 L368I probably benign Het
Diras1 T C 10: 81,022,081 E112G probably benign Het
Dopey1 T A 9: 86,502,997 M332K possibly damaging Het
Dpy19l1 T C 9: 24,414,267 *747W probably null Het
Dydc2 T G 14: 41,061,954 T71P probably damaging Het
Ggt1 T A 10: 75,585,238 I429N probably benign Het
Gm5114 G C 7: 39,411,276 L50V probably benign Het
Gm5121 T G 9: 57,334,483 noncoding transcript Het
Kidins220 A G 12: 25,013,391 D933G probably damaging Het
Kirrel3 A G 9: 35,013,276 K286R probably damaging Het
Klf5 T C 14: 99,301,508 I39T probably benign Het
Krt14 C T 11: 100,204,758 V274I possibly damaging Het
Meiob A G 17: 24,835,051 D364G probably benign Het
Mroh7 T A 4: 106,681,885 E1190D possibly damaging Het
Mtmr7 T C 8: 40,558,162 E285G possibly damaging Het
Nhsl1 C T 10: 18,526,503 T1159M probably damaging Het
Olfr1360 A G 13: 21,674,599 L115P probably damaging Het
Olfr366 C A 2: 37,219,889 N133K probably benign Het
Olfr382 G T 11: 73,516,625 D191E probably damaging Het
Pdlim5 T A 3: 142,304,299 H294L probably damaging Het
Pdzd8 A T 19: 59,299,625 D1114E probably benign Het
Plec C T 15: 76,199,671 probably benign Het
Ppp1r18 T C 17: 35,867,236 M1T probably null Het
Ppp4r3a G A 12: 101,058,511 T243I probably damaging Het
Prss41 C T 17: 23,842,416 V134I probably benign Het
Pter T C 2: 12,978,180 probably benign Het
Rasgef1b T G 5: 99,234,602 K176N possibly damaging Het
Reps1 T A 10: 18,056,010 D16E probably benign Het
Slc4a5 T A 6: 83,261,415 D73E probably benign Het
Smgc A T 15: 91,860,663 T146S possibly damaging Het
Sptbn1 A T 11: 30,143,174 W396R possibly damaging Het
Stkld1 A G 2: 26,943,987 E162G probably damaging Het
Tanc1 T C 2: 59,758,530 F106L probably benign Het
Tarbp1 A G 8: 126,467,144 Y340H probably damaging Het
Tenm2 T C 11: 36,047,182 I1556V possibly damaging Het
Tmem64 T C 4: 15,266,288 C113R probably damaging Het
Try4 T C 6: 41,305,043 F188L possibly damaging Het
Ttc25 G A 11: 100,554,061 A348T probably damaging Het
Ucn3 A G 13: 3,941,556 V32A probably benign Het
Vmn2r83 T A 10: 79,491,349 M597K possibly damaging Het
Wdr90 A G 17: 25,857,192 V491A probably benign Het
Xylt1 T A 7: 117,656,494 M763K possibly damaging Het
Zfp507 G T 7: 35,794,163 A485E probably damaging Het
Other mutations in Phf20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00928:Phf20 APN 2 156304816 critical splice donor site probably null
IGL01071:Phf20 APN 2 156294088 splice site probably null
IGL01125:Phf20 APN 2 156303184 splice site probably null
IGL01608:Phf20 APN 2 156276596 missense probably benign
IGL01610:Phf20 APN 2 156302889 nonsense probably null
IGL01845:Phf20 APN 2 156276657 nonsense probably null
IGL02364:Phf20 APN 2 156294097 missense possibly damaging 0.80
IGL02692:Phf20 APN 2 156298578 missense probably damaging 1.00
IGL03039:Phf20 APN 2 156298541 missense probably damaging 1.00
R0016:Phf20 UTSW 2 156267194 nonsense probably null
R0189:Phf20 UTSW 2 156303141 missense probably benign 0.02
R1532:Phf20 UTSW 2 156303049 missense possibly damaging 0.89
R1572:Phf20 UTSW 2 156287834 missense probably benign 0.17
R2007:Phf20 UTSW 2 156287954 missense probably benign 0.00
R2191:Phf20 UTSW 2 156276654 missense probably benign
R3011:Phf20 UTSW 2 156288026 missense probably benign 0.32
R3024:Phf20 UTSW 2 156287867 missense probably damaging 0.96
R4242:Phf20 UTSW 2 156307454 unclassified probably benign
R5053:Phf20 UTSW 2 156273862 missense probably benign 0.00
R5089:Phf20 UTSW 2 156302862 missense probably benign
R5382:Phf20 UTSW 2 156267497 missense probably damaging 1.00
R5649:Phf20 UTSW 2 156251768 splice site probably null
R5751:Phf20 UTSW 2 156267341 missense probably benign 0.01
R5805:Phf20 UTSW 2 156307294 missense probably damaging 0.99
R5988:Phf20 UTSW 2 156307330 missense probably damaging 1.00
R6179:Phf20 UTSW 2 156298653 missense probably damaging 1.00
R6243:Phf20 UTSW 2 156223400 missense probably benign 0.16
R6338:Phf20 UTSW 2 156273686 missense possibly damaging 0.93
R6351:Phf20 UTSW 2 156294210 missense possibly damaging 0.91
R6584:Phf20 UTSW 2 156294123 missense probably damaging 0.99
R7248:Phf20 UTSW 2 156293411 splice site probably null
R7329:Phf20 UTSW 2 156304632 missense probably damaging 0.96
R7387:Phf20 UTSW 2 156294240 missense probably damaging 1.00
R7528:Phf20 UTSW 2 156303008 nonsense probably null
R7603:Phf20 UTSW 2 156302851 missense probably benign
R7698:Phf20 UTSW 2 156294138 missense probably damaging 1.00
RF011:Phf20 UTSW 2 156304620 critical splice acceptor site probably benign
RF011:Phf20 UTSW 2 156304621 critical splice acceptor site probably benign
RF028:Phf20 UTSW 2 156304623 critical splice acceptor site probably benign
Predicted Primers PCR Primer
(F):5'- AGGTCATTGTGTGGCTACAG -3'
(R):5'- GGTAAGCATCTTCAGACACATCC -3'

Sequencing Primer
(F):5'- CTGTGGCCCTGCTTCAG -3'
(R):5'- CCTTACTGCTACGTTCAGAAGGACTG -3'
Posted On2017-01-03