Incidental Mutation 'R5707:Cela3b'
ID452011
Institutional Source Beutler Lab
Gene Symbol Cela3b
Ensembl Gene ENSMUSG00000023433
Gene Namechymotrypsin-like elastase family, member 3B
Synonyms2310074F01Rik, Ela3b, Ela3, 0910001F22Rik
MMRRC Submission 043332-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R5707 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location137420999-137430540 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 137424856 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 97 (Q97K)
Ref Sequence ENSEMBL: ENSMUSP00000099581 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102522]
Predicted Effect probably damaging
Transcript: ENSMUST00000102522
AA Change: Q97K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000099581
Gene: ENSMUSG00000023433
AA Change: Q97K

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Tryp_SPc 27 262 8.81e-94 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134565
Meta Mutation Damage Score 0.1801 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Elastases form a subfamily of serine proteases that hydrolyze many proteins in addition to elastin. Humans have six elastase genes which encode the structurally similar proteins elastase 1, 2, 2A, 2B, 3A, and 3B. Unlike other elastases, elastase 3B has little elastolytic activity. Like most of the human elastases, elastase 3B is secreted from the pancreas as a zymogen and, like other serine proteases such as trypsin, chymotrypsin and kallikrein, it has a digestive function in the intestine. Elastase 3B preferentially cleaves proteins after alanine residues. Elastase 3B may also function in the intestinal transport and metabolism of cholesterol. Both elastase 3A and elastase 3B have been referred to as protease E and as elastase 1, and excretion of this protein in fecal material is frequently used as a measure of pancreatic function in clinical assays. [provided by RefSeq, May 2009]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700125H20Rik A G 11: 85,173,312 N93S probably benign Het
9330182L06Rik A G 5: 9,441,698 Y686C probably damaging Het
Abca13 T C 11: 9,510,620 L4210P probably damaging Het
Adcy6 T C 15: 98,598,741 T518A probably damaging Het
Adgb C T 10: 10,391,757 V940I probably damaging Het
Aqp11 A G 7: 97,737,428 V187A possibly damaging Het
Arhgef15 A G 11: 68,954,715 S104P probably damaging Het
BC027072 G T 17: 71,751,572 A370E possibly damaging Het
Birc6 T A 17: 74,696,404 N4762K probably damaging Het
Cacna1e T C 1: 154,633,717 D264G probably damaging Het
Cenpc1 T A 5: 86,035,434 R499W possibly damaging Het
Cnr1 C A 4: 33,944,330 C239* probably null Het
Col6a2 T C 10: 76,611,031 K348E possibly damaging Het
Ctnnb1 C A 9: 120,955,168 L368I probably benign Het
Diras1 T C 10: 81,022,081 E112G probably benign Het
Dopey1 T A 9: 86,502,997 M332K possibly damaging Het
Dpy19l1 T C 9: 24,414,267 *747W probably null Het
Dydc2 T G 14: 41,061,954 T71P probably damaging Het
Ggt1 T A 10: 75,585,238 I429N probably benign Het
Gm5114 G C 7: 39,411,276 L50V probably benign Het
Gm5121 T G 9: 57,334,483 noncoding transcript Het
Kidins220 A G 12: 25,013,391 D933G probably damaging Het
Kirrel3 A G 9: 35,013,276 K286R probably damaging Het
Klf5 T C 14: 99,301,508 I39T probably benign Het
Krt14 C T 11: 100,204,758 V274I possibly damaging Het
Meiob A G 17: 24,835,051 D364G probably benign Het
Mroh7 T A 4: 106,681,885 E1190D possibly damaging Het
Mtmr7 T C 8: 40,558,162 E285G possibly damaging Het
Nhsl1 C T 10: 18,526,503 T1159M probably damaging Het
Olfr1360 A G 13: 21,674,599 L115P probably damaging Het
Olfr366 C A 2: 37,219,889 N133K probably benign Het
Olfr382 G T 11: 73,516,625 D191E probably damaging Het
Pdlim5 T A 3: 142,304,299 H294L probably damaging Het
Pdzd8 A T 19: 59,299,625 D1114E probably benign Het
Phf20 T G 2: 156,296,771 probably null Het
Plec C T 15: 76,199,671 probably benign Het
Ppp1r18 T C 17: 35,867,236 M1T probably null Het
Ppp4r3a G A 12: 101,058,511 T243I probably damaging Het
Prss41 C T 17: 23,842,416 V134I probably benign Het
Pter T C 2: 12,978,180 probably benign Het
Rasgef1b T G 5: 99,234,602 K176N possibly damaging Het
Reps1 T A 10: 18,056,010 D16E probably benign Het
Slc4a5 T A 6: 83,261,415 D73E probably benign Het
Smgc A T 15: 91,860,663 T146S possibly damaging Het
Sptbn1 A T 11: 30,143,174 W396R possibly damaging Het
Stkld1 A G 2: 26,943,987 E162G probably damaging Het
Tanc1 T C 2: 59,758,530 F106L probably benign Het
Tarbp1 A G 8: 126,467,144 Y340H probably damaging Het
Tenm2 T C 11: 36,047,182 I1556V possibly damaging Het
Tmem64 T C 4: 15,266,288 C113R probably damaging Het
Try4 T C 6: 41,305,043 F188L possibly damaging Het
Ttc25 G A 11: 100,554,061 A348T probably damaging Het
Ucn3 A G 13: 3,941,556 V32A probably benign Het
Vmn2r83 T A 10: 79,491,349 M597K possibly damaging Het
Wdr90 A G 17: 25,857,192 V491A probably benign Het
Xylt1 T A 7: 117,656,494 M763K possibly damaging Het
Zfp507 G T 7: 35,794,163 A485E probably damaging Het
Other mutations in Cela3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Cela3b APN 4 137423281 missense probably damaging 1.00
IGL00708:Cela3b APN 4 137421969 missense probably benign
IGL01301:Cela3b APN 4 137423843 critical splice donor site probably null
IGL01613:Cela3b APN 4 137425071 missense possibly damaging 0.66
ANU18:Cela3b UTSW 4 137423843 critical splice donor site probably null
R0669:Cela3b UTSW 4 137428530 missense probably benign 0.06
R2937:Cela3b UTSW 4 137423263 missense probably benign 0.01
R2938:Cela3b UTSW 4 137423263 missense probably benign 0.01
R4327:Cela3b UTSW 4 137423931 missense probably benign 0.26
R4451:Cela3b UTSW 4 137421044 utr 3 prime probably benign
R5059:Cela3b UTSW 4 137424870 missense probably benign 0.00
R7952:Cela3b UTSW 4 137421908 missense probably benign 0.27
X0019:Cela3b UTSW 4 137423310 missense probably damaging 1.00
X0019:Cela3b UTSW 4 137423311 missense probably damaging 1.00
Z1177:Cela3b UTSW 4 137428484 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGGATTCTGACCAAGATGGG -3'
(R):5'- TGCATCTCGTGAGTTCCACC -3'

Sequencing Primer
(F):5'- TTTAGTTATCGTAGCTACCCACAG -3'
(R):5'- GTGAGTTCCACCCCCTATGC -3'
Posted On2017-01-03