Incidental Mutation 'R0551:Pgap6'
ID 45202
Institutional Source Beutler Lab
Gene Symbol Pgap6
Ensembl Gene ENSMUSG00000024180
Gene Name post-glycosylphosphatidylinositol attachment to proteins 6
Synonyms Rxylt1, Tmem8, M83
MMRRC Submission 038743-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.090) question?
Stock # R0551 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 26332290-26342228 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 26339576 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Lysine at position 605 (Q605K)
Ref Sequence ENSEMBL: ENSMUSP00000025010 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025010] [ENSMUST00000025014] [ENSMUST00000128597]
AlphaFold Q9ESN3
Predicted Effect probably damaging
Transcript: ENSMUST00000025010
AA Change: Q605K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025010
Gene: ENSMUSG00000024180
AA Change: Q605K

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
EGF 495 531 1.99e1 SMART
Pfam:DUF3522 541 725 1e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000025014
SMART Domains Protein: ENSMUSP00000025014
Gene: ENSMUSG00000024181

DomainStartEndE-ValueType
Pfam:Ribosomal_L28 77 138 3.8e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123132
Predicted Effect probably benign
Transcript: ENSMUST00000127647
SMART Domains Protein: ENSMUSP00000115369
Gene: ENSMUSG00000024181

DomainStartEndE-ValueType
PDB:4CE4|1 2 44 5e-19 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000128597
AA Change: Q113K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000121651
Gene: ENSMUSG00000024180
AA Change: Q113K

DomainStartEndE-ValueType
EGF 3 39 1.99e1 SMART
Pfam:DUF3522 47 143 2e-36 PFAM
Pfam:DUF3522 134 194 2.6e-17 PFAM
Meta Mutation Damage Score 0.9203 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency 99% (77/78)
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T A 14: 32,384,598 (GRCm39) T456S probably benign Het
Acmsd A T 1: 127,694,070 (GRCm39) K333N probably benign Het
Adcy2 T A 13: 68,944,658 (GRCm39) K241N probably damaging Het
Aebp1 A G 11: 5,817,955 (GRCm39) I77V probably benign Het
Albfm1 C T 5: 90,720,578 (GRCm39) P250S probably damaging Het
Ankrd35 A G 3: 96,591,276 (GRCm39) T521A probably benign Het
Arap2 C T 5: 62,798,666 (GRCm39) probably null Het
Arfgap3 A T 15: 83,227,338 (GRCm39) C25S probably damaging Het
Arhgap20 T A 9: 51,737,125 (GRCm39) probably benign Het
Arhgap39 C T 15: 76,619,086 (GRCm39) D833N probably damaging Het
Auts2 T C 5: 131,469,307 (GRCm39) E446G possibly damaging Het
Brwd1 C T 16: 95,837,174 (GRCm39) R886H probably damaging Het
Carm1 G A 9: 21,491,787 (GRCm39) probably null Het
Cdc5l G A 17: 45,726,610 (GRCm39) R321W probably damaging Het
Cfap54 A T 10: 92,860,984 (GRCm39) M841K probably benign Het
Clca4b T A 3: 144,634,387 (GRCm39) T69S probably damaging Het
Cpox A G 16: 58,495,753 (GRCm39) I357V probably benign Het
Diaph3 C A 14: 87,147,536 (GRCm39) V711L probably benign Het
Fabp3-ps1 T C 10: 86,567,904 (GRCm39) probably benign Het
Fam120b A T 17: 15,651,905 (GRCm39) probably benign Het
Fcho1 A G 8: 72,164,818 (GRCm39) S488P probably benign Het
Flcn A G 11: 59,686,574 (GRCm39) probably null Het
Flt3l A G 7: 44,781,690 (GRCm39) W234R probably damaging Het
Fzd7 G T 1: 59,522,443 (GRCm39) V109L probably damaging Het
G3bp1 A G 11: 55,379,969 (GRCm39) N101S probably benign Het
Gadd45g A G 13: 52,001,963 (GRCm39) E143G probably damaging Het
Ganab T G 19: 8,884,644 (GRCm39) I149S probably benign Het
Garnl3 A G 2: 32,906,750 (GRCm39) S413P probably damaging Het
Glis1 C T 4: 107,425,316 (GRCm39) probably null Het
Gm11563 A G 11: 99,549,539 (GRCm39) S72P unknown Het
Gpd1 T G 15: 99,618,510 (GRCm39) I188S possibly damaging Het
Gria2 A G 3: 80,639,333 (GRCm39) probably benign Het
Hpcal4 G T 4: 123,082,848 (GRCm39) A65S possibly damaging Het
Igsf10 G A 3: 59,236,089 (GRCm39) T1364I probably benign Het
Kdm4a T C 4: 117,995,428 (GRCm39) *1065W probably null Het
Klkb1 A G 8: 45,731,003 (GRCm39) probably null Het
Lipo3 T C 19: 33,557,951 (GRCm39) D147G probably damaging Het
Lrp1 A G 10: 127,407,827 (GRCm39) S1821P probably benign Het
Macroh2a2 A G 10: 61,576,945 (GRCm39) S308P probably damaging Het
Manba T C 3: 135,223,734 (GRCm39) I207T probably damaging Het
Mark3 T A 12: 111,600,068 (GRCm39) S428T probably benign Het
Mfsd4a G A 1: 131,969,657 (GRCm39) T348I probably damaging Het
Mybbp1a A G 11: 72,339,202 (GRCm39) M880V probably benign Het
N4bp2 T A 5: 65,977,684 (GRCm39) probably null Het
Nrdc T G 4: 108,904,905 (GRCm39) I712S probably damaging Het
Nup210 G A 6: 90,998,466 (GRCm39) R774C possibly damaging Het
Obscn G A 11: 58,998,688 (GRCm39) R1395* probably null Het
Or5b102 T A 19: 13,041,658 (GRCm39) D294E probably benign Het
Pcdh7 T C 5: 57,879,336 (GRCm39) Y964H probably damaging Het
Plin4 T C 17: 56,413,756 (GRCm39) T290A probably benign Het
Ppara T C 15: 85,671,306 (GRCm39) probably benign Het
Psg21 T G 7: 18,386,565 (GRCm39) probably null Het
Ptar1 C A 19: 23,697,704 (GRCm39) N405K probably benign Het
Ralgps2 A G 1: 156,660,233 (GRCm39) probably null Het
Rnf6 T A 5: 146,148,205 (GRCm39) N271I possibly damaging Het
Sis T C 3: 72,832,740 (GRCm39) D1019G possibly damaging Het
Slc37a3 A G 6: 39,329,688 (GRCm39) probably benign Het
Slc49a3 A G 5: 108,592,331 (GRCm39) probably benign Het
Slc6a12 G A 6: 121,333,877 (GRCm39) V238I probably damaging Het
Sntg1 C A 1: 8,624,960 (GRCm39) V279L possibly damaging Het
Sorbs1 T A 19: 40,300,260 (GRCm39) E567D probably damaging Het
Sp110 C A 1: 85,516,821 (GRCm39) probably benign Het
Ssu2 A G 6: 112,357,515 (GRCm39) V175A possibly damaging Het
Stk36 G A 1: 74,655,780 (GRCm39) E428K probably benign Het
Teddm1b A T 1: 153,751,090 (GRCm39) I300F possibly damaging Het
Thy1 T C 9: 43,958,645 (GRCm39) V129A probably damaging Het
Tiam2 T A 17: 3,479,229 (GRCm39) M654K probably damaging Het
Tmem69 T C 4: 116,410,470 (GRCm39) S167G probably benign Het
Tmem81 C G 1: 132,435,567 (GRCm39) I124M probably damaging Het
Tspan10 A G 11: 120,335,244 (GRCm39) D118G probably damaging Het
Tspo2 A G 17: 48,755,841 (GRCm39) probably benign Het
Ttn G A 2: 76,738,672 (GRCm39) Q4002* probably null Het
Tyro3 G A 2: 119,647,385 (GRCm39) R834Q probably damaging Het
Ugt2b1 T C 5: 87,073,943 (GRCm39) K139E probably benign Het
Vmn1r9 A T 6: 57,048,524 (GRCm39) I200F probably benign Het
Other mutations in Pgap6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Pgap6 APN 17 26,336,493 (GRCm39) missense probably damaging 0.96
IGL01014:Pgap6 APN 17 26,335,983 (GRCm39) unclassified probably benign
IGL02167:Pgap6 APN 17 26,338,045 (GRCm39) missense probably damaging 1.00
IGL02375:Pgap6 APN 17 26,338,473 (GRCm39) missense probably benign 0.05
IGL02892:Pgap6 APN 17 26,338,094 (GRCm39) missense probably damaging 1.00
IGL02931:Pgap6 APN 17 26,336,923 (GRCm39) missense probably benign
IGL03005:Pgap6 APN 17 26,337,911 (GRCm39) missense probably benign 0.01
IGL03124:Pgap6 APN 17 26,335,808 (GRCm39) missense probably damaging 0.98
IGL03046:Pgap6 UTSW 17 26,338,414 (GRCm39) splice site probably null
R0555:Pgap6 UTSW 17 26,336,088 (GRCm39) missense probably benign 0.19
R1502:Pgap6 UTSW 17 26,339,290 (GRCm39) missense possibly damaging 0.82
R1593:Pgap6 UTSW 17 26,337,381 (GRCm39) missense possibly damaging 0.63
R1688:Pgap6 UTSW 17 26,337,882 (GRCm39) missense possibly damaging 0.94
R1829:Pgap6 UTSW 17 26,341,194 (GRCm39) missense probably damaging 1.00
R2071:Pgap6 UTSW 17 26,341,017 (GRCm39) missense probably damaging 1.00
R2117:Pgap6 UTSW 17 26,336,858 (GRCm39) missense possibly damaging 0.67
R3609:Pgap6 UTSW 17 26,337,860 (GRCm39) missense probably benign 0.23
R3610:Pgap6 UTSW 17 26,337,860 (GRCm39) missense probably benign 0.23
R4564:Pgap6 UTSW 17 26,336,837 (GRCm39) missense possibly damaging 0.80
R4749:Pgap6 UTSW 17 26,335,757 (GRCm39) missense probably damaging 1.00
R4777:Pgap6 UTSW 17 26,340,515 (GRCm39) missense probably damaging 1.00
R4913:Pgap6 UTSW 17 26,339,513 (GRCm39) missense probably damaging 1.00
R5098:Pgap6 UTSW 17 26,337,902 (GRCm39) missense probably damaging 1.00
R5126:Pgap6 UTSW 17 26,340,614 (GRCm39) missense probably damaging 0.99
R5640:Pgap6 UTSW 17 26,337,846 (GRCm39) missense possibly damaging 0.50
R5722:Pgap6 UTSW 17 26,339,536 (GRCm39) frame shift probably null
R5723:Pgap6 UTSW 17 26,339,536 (GRCm39) frame shift probably null
R5739:Pgap6 UTSW 17 26,339,425 (GRCm39) missense probably damaging 1.00
R5927:Pgap6 UTSW 17 26,340,972 (GRCm39) missense probably benign 0.34
R6587:Pgap6 UTSW 17 26,340,538 (GRCm39) missense probably benign 0.03
R6723:Pgap6 UTSW 17 26,339,610 (GRCm39) missense probably damaging 0.96
R7588:Pgap6 UTSW 17 26,341,017 (GRCm39) missense probably damaging 1.00
R7621:Pgap6 UTSW 17 26,336,865 (GRCm39) missense probably benign 0.00
R7653:Pgap6 UTSW 17 26,339,423 (GRCm39) missense probably damaging 1.00
R7771:Pgap6 UTSW 17 26,341,047 (GRCm39) missense probably damaging 1.00
R8037:Pgap6 UTSW 17 26,336,509 (GRCm39) missense possibly damaging 0.63
R8493:Pgap6 UTSW 17 26,340,931 (GRCm39) missense probably damaging 1.00
R8956:Pgap6 UTSW 17 26,339,374 (GRCm39) missense possibly damaging 0.89
R9048:Pgap6 UTSW 17 26,340,515 (GRCm39) missense probably damaging 1.00
R9574:Pgap6 UTSW 17 26,337,861 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CACCATGTTCTTCTCCACGGTAGG -3'
(R):5'- TGTCCAGATGCTGCATAAAATCCCC -3'

Sequencing Primer
(F):5'- CTTCTCCACGGTAGGCTTGG -3'
(R):5'- ctgccctgactcctctttg -3'
Posted On 2013-06-11