Mutagenetix > Incidental Mutation

Incidental Mutation 'R5707:Tarbp1'

452022

Institutional Source

Beutler Lab

Gene Symbol

Tarbp1

Ensembl Gene

ENSMUSG00000090290

Gene Name

TAR RNA binding protein 1

Synonyms

Gm17296

MMRRC Submission

043332-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5707 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

126425329-126475065 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 126467144 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 340 (Y340H)

Ref Sequence

ENSEMBL: ENSMUSP00000129815 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000170518]

AlphaFold

E9Q368

Predicted Effect

probably damaging
Transcript: ENSMUST00000170518
AA Change: Y340H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000129815
Gene: ENSMUSG00000090290
AA Change: Y340H

Domain	Start	End	E-Value	Type
low complexity region	17	31	N/A	INTRINSIC
low complexity region	47	57	N/A	INTRINSIC
low complexity region	77	97	N/A	INTRINSIC
low complexity region	112	127	N/A	INTRINSIC
low complexity region	195	207	N/A	INTRINSIC
SCOP:d1gw5a_	1059	1260	3e-3	SMART
Pfam:SpoU_methylase	1421	1564	2.2e-32	PFAM

Meta Mutation Damage Score

0.7686

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.4%

Validation Efficiency

97% (56/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HIV-1, the causative agent of acquired immunodeficiency syndrome (AIDS), contains an RNA genome that produces a chromosomally integrated DNA during the replicative cycle. Activation of HIV-1 gene expression by the transactivator Tat is dependent on an RNA regulatory element (TAR) located downstream of the transcription initiation site. This element forms a stable stem-loop structure and can be bound by either the protein encoded by this gene or by RNA polymerase II. This protein may act to disengage RNA polymerase II from TAR during transcriptional elongation. Alternatively spliced transcripts of this gene may exist, but their full-length natures have not been determined. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700125H20Rik	A	G	11: 85,173,312	N93S	probably benign	Het
9330182L06Rik	A	G	5: 9,441,698	Y686C	probably damaging	Het
Abca13	T	C	11: 9,510,620	L4210P	probably damaging	Het
Adcy6	T	C	15: 98,598,741	T518A	probably damaging	Het
Adgb	C	T	10: 10,391,757	V940I	probably damaging	Het
Aqp11	A	G	7: 97,737,428	V187A	possibly damaging	Het
Arhgef15	A	G	11: 68,954,715	S104P	probably damaging	Het
BC027072	G	T	17: 71,751,572	A370E	possibly damaging	Het
Birc6	T	A	17: 74,696,404	N4762K	probably damaging	Het
Cacna1e	T	C	1: 154,633,717	D264G	probably damaging	Het
Cela3b	G	T	4: 137,424,856	Q97K	probably damaging	Het
Cenpc1	T	A	5: 86,035,434	R499W	possibly damaging	Het
Cnr1	C	A	4: 33,944,330	C239*	probably null	Het
Col6a2	T	C	10: 76,611,031	K348E	possibly damaging	Het
Ctnnb1	C	A	9: 120,955,168	L368I	probably benign	Het
Diras1	T	C	10: 81,022,081	E112G	probably benign	Het
Dopey1	T	A	9: 86,502,997	M332K	possibly damaging	Het
Dpy19l1	T	C	9: 24,414,267	*747W	probably null	Het
Dydc2	T	G	14: 41,061,954	T71P	probably damaging	Het
Ggt1	T	A	10: 75,585,238	I429N	probably benign	Het
Gm5114	G	C	7: 39,411,276	L50V	probably benign	Het
Gm5121	T	G	9: 57,334,483		noncoding transcript	Het
Kidins220	A	G	12: 25,013,391	D933G	probably damaging	Het
Kirrel3	A	G	9: 35,013,276	K286R	probably damaging	Het
Klf5	T	C	14: 99,301,508	I39T	probably benign	Het
Krt14	C	T	11: 100,204,758	V274I	possibly damaging	Het
Meiob	A	G	17: 24,835,051	D364G	probably benign	Het
Mroh7	T	A	4: 106,681,885	E1190D	possibly damaging	Het
Mtmr7	T	C	8: 40,558,162	E285G	possibly damaging	Het
Nhsl1	C	T	10: 18,526,503	T1159M	probably damaging	Het
Olfr1360	A	G	13: 21,674,599	L115P	probably damaging	Het
Olfr366	C	A	2: 37,219,889	N133K	probably benign	Het
Olfr382	G	T	11: 73,516,625	D191E	probably damaging	Het
Pdlim5	T	A	3: 142,304,299	H294L	probably damaging	Het
Pdzd8	A	T	19: 59,299,625	D1114E	probably benign	Het
Phf20	T	G	2: 156,296,771		probably null	Het
Plec	C	T	15: 76,199,671		probably benign	Het
Ppp1r18	T	C	17: 35,867,236	M1T	probably null	Het
Ppp4r3a	G	A	12: 101,058,511	T243I	probably damaging	Het
Prss41	C	T	17: 23,842,416	V134I	probably benign	Het
Pter	T	C	2: 12,978,180		probably benign	Het
Rasgef1b	T	G	5: 99,234,602	K176N	possibly damaging	Het
Reps1	T	A	10: 18,056,010	D16E	probably benign	Het
Slc4a5	T	A	6: 83,261,415	D73E	probably benign	Het
Smgc	A	T	15: 91,860,663	T146S	possibly damaging	Het
Sptbn1	A	T	11: 30,143,174	W396R	possibly damaging	Het
Stkld1	A	G	2: 26,943,987	E162G	probably damaging	Het
Tanc1	T	C	2: 59,758,530	F106L	probably benign	Het
Tenm2	T	C	11: 36,047,182	I1556V	possibly damaging	Het
Tmem64	T	C	4: 15,266,288	C113R	probably damaging	Het
Try4	T	C	6: 41,305,043	F188L	possibly damaging	Het
Ttc25	G	A	11: 100,554,061	A348T	probably damaging	Het
Ucn3	A	G	13: 3,941,556	V32A	probably benign	Het
Vmn2r83	T	A	10: 79,491,349	M597K	possibly damaging	Het
Wdr90	A	G	17: 25,857,192	V491A	probably benign	Het
Xylt1	T	A	7: 117,656,494	M763K	possibly damaging	Het
Zfp507	G	T	7: 35,794,163	A485E	probably damaging	Het

Other mutations in Tarbp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00985:Tarbp1	APN	8	126459161	missense	probably damaging	1.00
IGL01419:Tarbp1	APN	8	126428155	missense	probably benign	0.03
IGL01475:Tarbp1	APN	8	126433962	missense	probably benign	0.03
IGL01688:Tarbp1	APN	8	126447551	missense	probably damaging	1.00
IGL01772:Tarbp1	APN	8	126447231	splice site	probably benign
IGL02402:Tarbp1	APN	8	126450828	splice site	probably benign
IGL02899:Tarbp1	APN	8	126453844	missense	probably damaging	0.96
IGL03006:Tarbp1	APN	8	126444142	missense	probably damaging	1.00
IGL03273:Tarbp1	APN	8	126453835	missense	probably damaging	1.00
PIT4280001:Tarbp1	UTSW	8	126430847	missense	probably damaging	0.96
R0048:Tarbp1	UTSW	8	126447530	missense	probably damaging	1.00
R0309:Tarbp1	UTSW	8	126438928	splice site	probably benign
R0383:Tarbp1	UTSW	8	126447484	missense	probably benign	0.00
R0455:Tarbp1	UTSW	8	126440873	missense	probably benign	0.00
R0738:Tarbp1	UTSW	8	126438801	critical splice donor site	probably null
R1345:Tarbp1	UTSW	8	126448330	missense	probably benign	0.03
R1370:Tarbp1	UTSW	8	126448330	missense	probably benign	0.03
R1617:Tarbp1	UTSW	8	126444268	missense	possibly damaging	0.47
R1628:Tarbp1	UTSW	8	126430860	missense	possibly damaging	0.78
R1702:Tarbp1	UTSW	8	126428218	missense	probably damaging	1.00
R1873:Tarbp1	UTSW	8	126447047	missense	probably damaging	1.00
R2018:Tarbp1	UTSW	8	126428114	missense	probably damaging	1.00
R2019:Tarbp1	UTSW	8	126428114	missense	probably damaging	1.00
R2060:Tarbp1	UTSW	8	126447594	splice site	probably null
R2877:Tarbp1	UTSW	8	126427832	missense	probably damaging	1.00
R3008:Tarbp1	UTSW	8	126447421	missense	possibly damaging	0.46
R3875:Tarbp1	UTSW	8	126438799	splice site	probably benign
R3905:Tarbp1	UTSW	8	126428152	missense	probably damaging	1.00
R3923:Tarbp1	UTSW	8	126440771	missense	probably benign	0.00
R4420:Tarbp1	UTSW	8	126447080	missense	possibly damaging	0.59
R4570:Tarbp1	UTSW	8	126452233	missense	probably benign	0.00
R4610:Tarbp1	UTSW	8	126474330	missense	probably damaging	1.00
R4649:Tarbp1	UTSW	8	126447195	missense	probably damaging	0.96
R4802:Tarbp1	UTSW	8	126474889	missense	possibly damaging	0.75
R4951:Tarbp1	UTSW	8	126447445	missense	possibly damaging	0.94
R4953:Tarbp1	UTSW	8	126447445	missense	possibly damaging	0.94
R5254:Tarbp1	UTSW	8	126467156	missense	probably damaging	0.96
R5255:Tarbp1	UTSW	8	126428970	missense	probably benign	0.16
R5638:Tarbp1	UTSW	8	126450686	missense	probably damaging	1.00
R5696:Tarbp1	UTSW	8	126447340	missense	probably damaging	0.98
R5896:Tarbp1	UTSW	8	126452928	missense	probably benign	0.05
R6087:Tarbp1	UTSW	8	126428970	missense	probably benign	0.00
R6117:Tarbp1	UTSW	8	126427541	missense	probably benign	0.00
R6132:Tarbp1	UTSW	8	126434809	missense	probably benign	0.17
R6168:Tarbp1	UTSW	8	126448405	missense	possibly damaging	0.89
R6419:Tarbp1	UTSW	8	126459044	missense	possibly damaging	0.95
R6482:Tarbp1	UTSW	8	126450695	missense	probably benign	0.01
R6766:Tarbp1	UTSW	8	126447400	missense	probably benign	0.41
R6775:Tarbp1	UTSW	8	126436829	missense	probably benign	0.16
R6960:Tarbp1	UTSW	8	126429039	missense	possibly damaging	0.88
R7054:Tarbp1	UTSW	8	126474495	missense	possibly damaging	0.85
R7068:Tarbp1	UTSW	8	126427034	missense	probably damaging	1.00
R7454:Tarbp1	UTSW	8	126457677	missense	probably benign	0.19
R7519:Tarbp1	UTSW	8	126433900	missense	possibly damaging	0.87
R7760:Tarbp1	UTSW	8	126452807	missense	not run
R7837:Tarbp1	UTSW	8	126474561	missense	probably benign	0.00
R7882:Tarbp1	UTSW	8	126456493	missense	probably damaging	1.00
R7982:Tarbp1	UTSW	8	126444301	missense	probably damaging	1.00
R8166:Tarbp1	UTSW	8	126427128	missense	possibly damaging	0.79
R8517:Tarbp1	UTSW	8	126444195	missense	probably benign	0.29
R8838:Tarbp1	UTSW	8	126450830	splice site	probably benign
R8880:Tarbp1	UTSW	8	126471305	missense	probably damaging	1.00
R9061:Tarbp1	UTSW	8	126447141	missense	probably damaging	1.00
R9123:Tarbp1	UTSW	8	126447463	missense	possibly damaging	0.63
R9125:Tarbp1	UTSW	8	126447463	missense	possibly damaging	0.63
R9364:Tarbp1	UTSW	8	126450723	missense	probably benign	0.01
R9474:Tarbp1	UTSW	8	126429040	missense	probably benign	0.44
R9670:Tarbp1	UTSW	8	126456523	missense	probably null	1.00

Predicted Primers

PCR Primer
(F):5'- ACTGATGCATGTGACAGAGGC -3'
(R):5'- ACTGAGTTCTGCAAGCTCTGTG -3'

Sequencing Primer
(F):5'- TGCATGTGACAGAGGCATACC -3'
(R):5'- GTGTGTCATTAACAAGCTCACTGC -3'

Posted On

2017-01-03