Incidental Mutation 'R5707:Tenm2'
ID 452035
Institutional Source Beutler Lab
Gene Symbol Tenm2
Ensembl Gene ENSMUSG00000049336
Gene Name teneurin transmembrane protein 2
Synonyms 2610040L17Rik, 9330187F13Rik, D3Bwg1534e, Ten-m2, Odz2
MMRRC Submission 043332-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.471) question?
Stock # R5707 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 36006656-37235964 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 36047182 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 1556 (I1556V)
Ref Sequence ENSEMBL: ENSMUSP00000052014 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057207] [ENSMUST00000102801] [ENSMUST00000163524]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000057207
AA Change: I1556V

PolyPhen 2 Score 0.785 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000052014
Gene: ENSMUSG00000049336
AA Change: I1556V

DomainStartEndE-ValueType
Pfam:Ten_N 10 374 4.9e-177 PFAM
transmembrane domain 375 397 N/A INTRINSIC
EGF 575 603 5.62e0 SMART
EGF_like 606 634 4.93e1 SMART
EGF 639 668 1.76e1 SMART
EGF 671 700 1.43e-1 SMART
EGF 705 735 1.2e1 SMART
EGF 738 766 9.63e0 SMART
EGF 769 797 1.25e1 SMART
EGF 800 832 1.4e0 SMART
low complexity region 1459 1475 N/A INTRINSIC
low complexity region 2219 2230 N/A INTRINSIC
Pfam:Tox-GHH 2681 2758 1.4e-34 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000102801
AA Change: I1555V

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000099865
Gene: ENSMUSG00000049336
AA Change: I1555V

DomainStartEndE-ValueType
Pfam:Ten_N 9 374 2e-186 PFAM
transmembrane domain 375 397 N/A INTRINSIC
EGF 575 603 5.62e0 SMART
EGF_like 606 634 4.93e1 SMART
EGF 639 668 1.76e1 SMART
EGF 671 700 1.43e-1 SMART
EGF 705 735 1.2e1 SMART
EGF 737 765 9.63e0 SMART
EGF 768 796 1.25e1 SMART
EGF 799 831 1.4e0 SMART
low complexity region 1458 1474 N/A INTRINSIC
low complexity region 2218 2229 N/A INTRINSIC
Pfam:Tox-GHH 2679 2757 2e-34 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000163524
AA Change: I1555V

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000129951
Gene: ENSMUSG00000049336
AA Change: I1555V

DomainStartEndE-ValueType
Pfam:Ten_N 9 374 2e-186 PFAM
transmembrane domain 375 397 N/A INTRINSIC
EGF 575 603 5.62e0 SMART
EGF_like 606 634 4.93e1 SMART
EGF 639 668 1.76e1 SMART
EGF 671 700 1.43e-1 SMART
EGF 705 735 1.2e1 SMART
EGF 737 765 9.63e0 SMART
EGF 768 796 1.25e1 SMART
EGF 799 831 1.4e0 SMART
low complexity region 1458 1474 N/A INTRINSIC
low complexity region 2218 2229 N/A INTRINSIC
Pfam:Tox-GHH 2679 2757 2e-34 PFAM
Meta Mutation Damage Score 0.1122 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 97% (56/58)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele show abnormalities in the laterality and mapping of ipsilateral retinal projections that lead to loss of ipsilateral drive, defects in binocular vision, and impaired performance on a visual discrimination task. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700125H20Rik A G 11: 85,173,312 N93S probably benign Het
9330182L06Rik A G 5: 9,441,698 Y686C probably damaging Het
Abca13 T C 11: 9,510,620 L4210P probably damaging Het
Adcy6 T C 15: 98,598,741 T518A probably damaging Het
Adgb C T 10: 10,391,757 V940I probably damaging Het
Aqp11 A G 7: 97,737,428 V187A possibly damaging Het
Arhgef15 A G 11: 68,954,715 S104P probably damaging Het
BC027072 G T 17: 71,751,572 A370E possibly damaging Het
Birc6 T A 17: 74,696,404 N4762K probably damaging Het
Cacna1e T C 1: 154,633,717 D264G probably damaging Het
Cela3b G T 4: 137,424,856 Q97K probably damaging Het
Cenpc1 T A 5: 86,035,434 R499W possibly damaging Het
Cnr1 C A 4: 33,944,330 C239* probably null Het
Col6a2 T C 10: 76,611,031 K348E possibly damaging Het
Ctnnb1 C A 9: 120,955,168 L368I probably benign Het
Diras1 T C 10: 81,022,081 E112G probably benign Het
Dopey1 T A 9: 86,502,997 M332K possibly damaging Het
Dpy19l1 T C 9: 24,414,267 *747W probably null Het
Dydc2 T G 14: 41,061,954 T71P probably damaging Het
Ggt1 T A 10: 75,585,238 I429N probably benign Het
Gm5114 G C 7: 39,411,276 L50V probably benign Het
Gm5121 T G 9: 57,334,483 noncoding transcript Het
Kidins220 A G 12: 25,013,391 D933G probably damaging Het
Kirrel3 A G 9: 35,013,276 K286R probably damaging Het
Klf5 T C 14: 99,301,508 I39T probably benign Het
Krt14 C T 11: 100,204,758 V274I possibly damaging Het
Meiob A G 17: 24,835,051 D364G probably benign Het
Mroh7 T A 4: 106,681,885 E1190D possibly damaging Het
Mtmr7 T C 8: 40,558,162 E285G possibly damaging Het
Nhsl1 C T 10: 18,526,503 T1159M probably damaging Het
Olfr1360 A G 13: 21,674,599 L115P probably damaging Het
Olfr366 C A 2: 37,219,889 N133K probably benign Het
Olfr382 G T 11: 73,516,625 D191E probably damaging Het
Pdlim5 T A 3: 142,304,299 H294L probably damaging Het
Pdzd8 A T 19: 59,299,625 D1114E probably benign Het
Phf20 T G 2: 156,296,771 probably null Het
Plec C T 15: 76,199,671 probably benign Het
Ppp1r18 T C 17: 35,867,236 M1T probably null Het
Ppp4r3a G A 12: 101,058,511 T243I probably damaging Het
Prss41 C T 17: 23,842,416 V134I probably benign Het
Pter T C 2: 12,978,180 probably benign Het
Rasgef1b T G 5: 99,234,602 K176N possibly damaging Het
Reps1 T A 10: 18,056,010 D16E probably benign Het
Slc4a5 T A 6: 83,261,415 D73E probably benign Het
Smgc A T 15: 91,860,663 T146S possibly damaging Het
Sptbn1 A T 11: 30,143,174 W396R possibly damaging Het
Stkld1 A G 2: 26,943,987 E162G probably damaging Het
Tanc1 T C 2: 59,758,530 F106L probably benign Het
Tarbp1 A G 8: 126,467,144 Y340H probably damaging Het
Tmem64 T C 4: 15,266,288 C113R probably damaging Het
Try4 T C 6: 41,305,043 F188L possibly damaging Het
Ttc25 G A 11: 100,554,061 A348T probably damaging Het
Ucn3 A G 13: 3,941,556 V32A probably benign Het
Vmn2r83 T A 10: 79,491,349 M597K possibly damaging Het
Wdr90 A G 17: 25,857,192 V491A probably benign Het
Xylt1 T A 7: 117,656,494 M763K possibly damaging Het
Zfp507 G T 7: 35,794,163 A485E probably damaging Het
Other mutations in Tenm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Tenm2 APN 11 36206899 splice site probably benign
IGL00834:Tenm2 APN 11 36024258 missense probably damaging 1.00
IGL00911:Tenm2 APN 11 36008733 nonsense probably null
IGL00937:Tenm2 APN 11 36024623 missense probably damaging 1.00
IGL01154:Tenm2 APN 11 36041544 missense probably damaging 1.00
IGL01313:Tenm2 APN 11 36024248 missense probably damaging 0.98
IGL01346:Tenm2 APN 11 36027405 nonsense probably null
IGL01539:Tenm2 APN 11 36106827 missense possibly damaging 0.89
IGL01629:Tenm2 APN 11 36864884 missense probably damaging 0.98
IGL01780:Tenm2 APN 11 36046941 missense probably benign
IGL01821:Tenm2 APN 11 36023883 missense probably damaging 0.98
IGL01988:Tenm2 APN 11 36027251 missense probably damaging 1.00
IGL02002:Tenm2 APN 11 36207095 missense probably benign
IGL02449:Tenm2 APN 11 36023622 missense probably damaging 0.99
IGL02505:Tenm2 APN 11 36051916 nonsense probably null
IGL02649:Tenm2 APN 11 36207085 missense possibly damaging 0.85
IGL02688:Tenm2 APN 11 36068458 missense probably benign 0.05
IGL02801:Tenm2 APN 11 36047030 nonsense probably null
IGL02928:Tenm2 APN 11 36027170 missense possibly damaging 0.69
IGL02940:Tenm2 APN 11 36041644 missense probably damaging 1.00
IGL03202:Tenm2 APN 11 36024548 missense probably damaging 1.00
IGL03213:Tenm2 APN 11 36023330 missense probably benign 0.05
IGL03276:Tenm2 APN 11 36072776 missense possibly damaging 0.95
IGL03296:Tenm2 APN 11 36052025 splice site probably null
IGL03381:Tenm2 APN 11 36068411 missense probably benign 0.01
IGL03398:Tenm2 APN 11 36024543 missense probably damaging 1.00
browser UTSW 11 36046765 critical splice donor site probably null
mosaic UTSW 11 36063775 critical splice donor site probably null
IGL02799:Tenm2 UTSW 11 36273408 missense probably damaging 1.00
PIT4260001:Tenm2 UTSW 11 36163730 missense probably damaging 1.00
PIT4382001:Tenm2 UTSW 11 36063902 missense probably damaging 0.99
R0004:Tenm2 UTSW 11 36023357 missense probably damaging 1.00
R0420:Tenm2 UTSW 11 36207124 splice site probably benign
R0537:Tenm2 UTSW 11 36163730 missense probably damaging 1.00
R0599:Tenm2 UTSW 11 36024780 missense possibly damaging 0.93
R0636:Tenm2 UTSW 11 36943976 missense probably damaging 1.00
R0693:Tenm2 UTSW 11 36024809 missense probably damaging 1.00
R0991:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R0992:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1167:Tenm2 UTSW 11 36864684 missense probably benign 0.30
R1177:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1178:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1179:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1180:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1181:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1193:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1194:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1195:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1195:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1195:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1259:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1265:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1267:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1268:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1269:Tenm2 UTSW 11 36008358 missense possibly damaging 0.64
R1270:Tenm2 UTSW 11 36041659 missense probably damaging 1.00
R1272:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1273:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1311:Tenm2 UTSW 11 36068594 splice site probably benign
R1374:Tenm2 UTSW 11 36008454 missense probably benign 0.00
R1542:Tenm2 UTSW 11 36300220 missense probably damaging 0.99
R1573:Tenm2 UTSW 11 36047069 missense probably damaging 1.00
R1579:Tenm2 UTSW 11 36106783 missense probably damaging 1.00
R1697:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1722:Tenm2 UTSW 11 36008103 missense probably damaging 1.00
R1756:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1793:Tenm2 UTSW 11 36023382 missense probably damaging 0.99
R1950:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1954:Tenm2 UTSW 11 36047547 missense possibly damaging 0.87
R2025:Tenm2 UTSW 11 36047264 nonsense probably null
R2117:Tenm2 UTSW 11 36024854 missense probably damaging 1.00
R2244:Tenm2 UTSW 11 36864862 missense probably damaging 0.98
R2298:Tenm2 UTSW 11 36046777 missense possibly damaging 0.62
R2432:Tenm2 UTSW 11 36027191 missense probably damaging 1.00
R3014:Tenm2 UTSW 11 36023973 missense probably damaging 1.00
R3115:Tenm2 UTSW 11 36023366 missense probably damaging 1.00
R3684:Tenm2 UTSW 11 36051817 missense probably benign 0.00
R3685:Tenm2 UTSW 11 36051817 missense probably benign 0.00
R3705:Tenm2 UTSW 11 36068326 missense probably damaging 0.97
R3820:Tenm2 UTSW 11 36024320 missense probably damaging 0.98
R3821:Tenm2 UTSW 11 36024320 missense probably damaging 0.98
R3822:Tenm2 UTSW 11 36024320 missense probably damaging 0.98
R3844:Tenm2 UTSW 11 36047538 missense probably damaging 0.98
R3878:Tenm2 UTSW 11 36139574 critical splice donor site probably null
R4019:Tenm2 UTSW 11 36047074 missense probably benign 0.04
R4062:Tenm2 UTSW 11 36008655 missense probably damaging 1.00
R4367:Tenm2 UTSW 11 36027398 missense probably benign
R4395:Tenm2 UTSW 11 36024624 missense probably benign 0.23
R4508:Tenm2 UTSW 11 36008345 missense possibly damaging 0.82
R4534:Tenm2 UTSW 11 36063104 missense possibly damaging 0.64
R4539:Tenm2 UTSW 11 36046780 missense probably damaging 1.00
R4644:Tenm2 UTSW 11 36047136 missense probably benign 0.00
R4661:Tenm2 UTSW 11 36024448 missense probably damaging 0.99
R4669:Tenm2 UTSW 11 36010487 missense probably damaging 1.00
R4687:Tenm2 UTSW 11 36049097 missense probably benign
R4711:Tenm2 UTSW 11 36300212 missense probably damaging 0.98
R4816:Tenm2 UTSW 11 36027290 missense probably damaging 1.00
R4843:Tenm2 UTSW 11 36024020 missense probably damaging 1.00
R4850:Tenm2 UTSW 11 36023488 nonsense probably null
R4870:Tenm2 UTSW 11 36078569 missense probably damaging 1.00
R5058:Tenm2 UTSW 11 36207080 missense possibly damaging 0.80
R5071:Tenm2 UTSW 11 36068381 missense probably damaging 0.99
R5073:Tenm2 UTSW 11 36068381 missense probably damaging 0.99
R5074:Tenm2 UTSW 11 36068381 missense probably damaging 0.99
R5081:Tenm2 UTSW 11 36024633 missense possibly damaging 0.95
R5093:Tenm2 UTSW 11 36944162 missense probably damaging 1.00
R5170:Tenm2 UTSW 11 36024806 missense probably damaging 0.98
R5253:Tenm2 UTSW 11 36047201 nonsense probably null
R5343:Tenm2 UTSW 11 36069503 missense probably benign 0.00
R5493:Tenm2 UTSW 11 36864676 missense probably benign 0.01
R5600:Tenm2 UTSW 11 36163714 splice site probably null
R5677:Tenm2 UTSW 11 36141683 missense probably damaging 0.98
R5703:Tenm2 UTSW 11 36023799 missense probably benign 0.34
R6026:Tenm2 UTSW 11 36072729 critical splice donor site probably null
R6063:Tenm2 UTSW 11 36163717 critical splice donor site probably null
R6086:Tenm2 UTSW 11 36008646 missense possibly damaging 0.64
R6151:Tenm2 UTSW 11 36008783 missense probably damaging 1.00
R6169:Tenm2 UTSW 11 36139690 missense probably damaging 0.99
R6193:Tenm2 UTSW 11 36046794 missense probably damaging 1.00
R6405:Tenm2 UTSW 11 36864859 missense probably benign 0.44
R6477:Tenm2 UTSW 11 36010507 critical splice acceptor site probably null
R6607:Tenm2 UTSW 11 36063775 critical splice donor site probably null
R6668:Tenm2 UTSW 11 36046765 critical splice donor site probably null
R6825:Tenm2 UTSW 11 36046884 missense probably benign 0.02
R6885:Tenm2 UTSW 11 36023580 missense possibly damaging 0.95
R7017:Tenm2 UTSW 11 36171409 missense probably damaging 0.98
R7115:Tenm2 UTSW 11 36163817 missense probably damaging 0.99
R7153:Tenm2 UTSW 11 36024182 missense probably damaging 0.98
R7173:Tenm2 UTSW 11 36041551 missense probably damaging 0.99
R7199:Tenm2 UTSW 11 36171436 missense probably damaging 1.00
R7205:Tenm2 UTSW 11 36049129 missense probably damaging 0.99
R7250:Tenm2 UTSW 11 36072798 missense probably damaging 1.00
R7290:Tenm2 UTSW 11 36023471 missense probably damaging 1.00
R7366:Tenm2 UTSW 11 36069414 missense probably benign 0.09
R7432:Tenm2 UTSW 11 36864941 missense probably benign
R7504:Tenm2 UTSW 11 36139743 missense probably damaging 1.00
R7513:Tenm2 UTSW 11 36051900 missense probably benign 0.34
R7523:Tenm2 UTSW 11 36078581 splice site probably null
R7527:Tenm2 UTSW 11 36206976 missense probably damaging 1.00
R7648:Tenm2 UTSW 11 36106736 missense probably damaging 1.00
R7653:Tenm2 UTSW 11 36047347 missense probably benign 0.09
R7717:Tenm2 UTSW 11 36864935 missense probably damaging 0.97
R7739:Tenm2 UTSW 11 36069561 missense possibly damaging 0.50
R7762:Tenm2 UTSW 11 36023306 missense possibly damaging 0.74
R7786:Tenm2 UTSW 11 36010449 missense probably damaging 0.99
R7803:Tenm2 UTSW 11 36047116 missense probably damaging 0.98
R7834:Tenm2 UTSW 11 36024854 missense probably damaging 1.00
R7838:Tenm2 UTSW 11 36106799 missense probably benign 0.02
R8073:Tenm2 UTSW 11 36139644 missense possibly damaging 0.56
R8076:Tenm2 UTSW 11 36027221 missense probably benign 0.23
R8109:Tenm2 UTSW 11 36008310 missense probably benign
R8306:Tenm2 UTSW 11 36069369 missense possibly damaging 0.52
R8352:Tenm2 UTSW 11 36023601 missense probably damaging 0.98
R8452:Tenm2 UTSW 11 36023601 missense probably damaging 0.98
R8864:Tenm2 UTSW 11 36027195 missense possibly damaging 0.95
R8880:Tenm2 UTSW 11 36051961 missense probably damaging 0.99
R8943:Tenm2 UTSW 11 36944034 missense probably damaging 0.98
R8969:Tenm2 UTSW 11 36051861 missense probably damaging 0.99
R9168:Tenm2 UTSW 11 36039895 missense probably damaging 1.00
R9279:Tenm2 UTSW 11 36068476 missense probably benign 0.00
R9294:Tenm2 UTSW 11 36024500 missense probably damaging 0.98
R9320:Tenm2 UTSW 11 36023647 missense probably damaging 0.99
R9373:Tenm2 UTSW 11 36039886 missense probably damaging 1.00
R9408:Tenm2 UTSW 11 36069419 missense probably damaging 1.00
R9410:Tenm2 UTSW 11 36141569 missense probably damaging 0.99
R9454:Tenm2 UTSW 11 36221459 missense probably benign
R9489:Tenm2 UTSW 11 36943964 missense probably damaging 0.99
R9711:Tenm2 UTSW 11 36024514 missense probably damaging 0.99
RF021:Tenm2 UTSW 11 36024203 missense possibly damaging 0.95
X0018:Tenm2 UTSW 11 36024200 missense probably damaging 1.00
X0063:Tenm2 UTSW 11 36024730 missense probably benign
Z1088:Tenm2 UTSW 11 36273267 missense probably damaging 1.00
Z1177:Tenm2 UTSW 11 36008234 missense possibly damaging 0.95
Z1177:Tenm2 UTSW 11 36300335 missense probably damaging 0.98
Z1177:Tenm2 UTSW 11 36385130 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCAGCGCTGTATGTGAAATTGTAC -3'
(R):5'- ACATCACTGAGACGGACGAG -3'

Sequencing Primer
(F):5'- GTGAAATTGTACAAGTACTCCCCAG -3'
(R):5'- GAGAAGAAGATCAACCGCCTACG -3'
Posted On 2017-01-03