Incidental Mutation 'R5707:1700125H20Rik'
ID452038
Institutional Source Beutler Lab
Gene Symbol 1700125H20Rik
Ensembl Gene ENSMUSG00000018479
Gene NameRIKEN cDNA 1700125H20 gene
Synonyms
MMRRC Submission 043332-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R5707 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location85170404-85181145 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 85173312 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 93 (N93S)
Ref Sequence ENSEMBL: ENSMUSP00000018623 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018623] [ENSMUST00000100681]
Predicted Effect probably benign
Transcript: ENSMUST00000018623
AA Change: N93S

PolyPhen 2 Score 0.394 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000018623
Gene: ENSMUSG00000018479
AA Change: N93S

DomainStartEndE-ValueType
DUF4208 31 134 1.43e-35 SMART
low complexity region 211 230 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100681
SMART Domains Protein: ENSMUSP00000098248
Gene: ENSMUSG00000018479

DomainStartEndE-ValueType
Blast:DUF4208 1 24 1e-7 BLAST
low complexity region 101 120 N/A INTRINSIC
Meta Mutation Damage Score 0.0773 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 97% (56/58)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik A G 5: 9,441,698 Y686C probably damaging Het
Abca13 T C 11: 9,510,620 L4210P probably damaging Het
Adcy6 T C 15: 98,598,741 T518A probably damaging Het
Adgb C T 10: 10,391,757 V940I probably damaging Het
Aqp11 A G 7: 97,737,428 V187A possibly damaging Het
Arhgef15 A G 11: 68,954,715 S104P probably damaging Het
BC027072 G T 17: 71,751,572 A370E possibly damaging Het
Birc6 T A 17: 74,696,404 N4762K probably damaging Het
Cacna1e T C 1: 154,633,717 D264G probably damaging Het
Cela3b G T 4: 137,424,856 Q97K probably damaging Het
Cenpc1 T A 5: 86,035,434 R499W possibly damaging Het
Cnr1 C A 4: 33,944,330 C239* probably null Het
Col6a2 T C 10: 76,611,031 K348E possibly damaging Het
Ctnnb1 C A 9: 120,955,168 L368I probably benign Het
Diras1 T C 10: 81,022,081 E112G probably benign Het
Dopey1 T A 9: 86,502,997 M332K possibly damaging Het
Dpy19l1 T C 9: 24,414,267 *747W probably null Het
Dydc2 T G 14: 41,061,954 T71P probably damaging Het
Ggt1 T A 10: 75,585,238 I429N probably benign Het
Gm5114 G C 7: 39,411,276 L50V probably benign Het
Gm5121 T G 9: 57,334,483 noncoding transcript Het
Kidins220 A G 12: 25,013,391 D933G probably damaging Het
Kirrel3 A G 9: 35,013,276 K286R probably damaging Het
Klf5 T C 14: 99,301,508 I39T probably benign Het
Krt14 C T 11: 100,204,758 V274I possibly damaging Het
Meiob A G 17: 24,835,051 D364G probably benign Het
Mroh7 T A 4: 106,681,885 E1190D possibly damaging Het
Mtmr7 T C 8: 40,558,162 E285G possibly damaging Het
Nhsl1 C T 10: 18,526,503 T1159M probably damaging Het
Olfr1360 A G 13: 21,674,599 L115P probably damaging Het
Olfr366 C A 2: 37,219,889 N133K probably benign Het
Olfr382 G T 11: 73,516,625 D191E probably damaging Het
Pdlim5 T A 3: 142,304,299 H294L probably damaging Het
Pdzd8 A T 19: 59,299,625 D1114E probably benign Het
Phf20 T G 2: 156,296,771 probably null Het
Plec C T 15: 76,199,671 probably benign Het
Ppp1r18 T C 17: 35,867,236 M1T probably null Het
Ppp4r3a G A 12: 101,058,511 T243I probably damaging Het
Prss41 C T 17: 23,842,416 V134I probably benign Het
Pter T C 2: 12,978,180 probably benign Het
Rasgef1b T G 5: 99,234,602 K176N possibly damaging Het
Reps1 T A 10: 18,056,010 D16E probably benign Het
Slc4a5 T A 6: 83,261,415 D73E probably benign Het
Smgc A T 15: 91,860,663 T146S possibly damaging Het
Sptbn1 A T 11: 30,143,174 W396R possibly damaging Het
Stkld1 A G 2: 26,943,987 E162G probably damaging Het
Tanc1 T C 2: 59,758,530 F106L probably benign Het
Tarbp1 A G 8: 126,467,144 Y340H probably damaging Het
Tenm2 T C 11: 36,047,182 I1556V possibly damaging Het
Tmem64 T C 4: 15,266,288 C113R probably damaging Het
Try4 T C 6: 41,305,043 F188L possibly damaging Het
Ttc25 G A 11: 100,554,061 A348T probably damaging Het
Ucn3 A G 13: 3,941,556 V32A probably benign Het
Vmn2r83 T A 10: 79,491,349 M597K possibly damaging Het
Wdr90 A G 17: 25,857,192 V491A probably benign Het
Xylt1 T A 7: 117,656,494 M763K possibly damaging Het
Zfp507 G T 7: 35,794,163 A485E probably damaging Het
Other mutations in 1700125H20Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01490:1700125H20Rik APN 11 85178312 missense probably damaging 0.97
IGL01745:1700125H20Rik APN 11 85172870 missense probably benign 0.02
R0178:1700125H20Rik UTSW 11 85178438 missense probably benign 0.09
R1614:1700125H20Rik UTSW 11 85172864 missense possibly damaging 0.46
R3161:1700125H20Rik UTSW 11 85173284 missense probably damaging 0.98
R5796:1700125H20Rik UTSW 11 85173275 missense probably null 0.77
R6033:1700125H20Rik UTSW 11 85178372 missense probably damaging 1.00
R6033:1700125H20Rik UTSW 11 85178372 missense probably damaging 1.00
X0066:1700125H20Rik UTSW 11 85178349 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TAGTCAGGCCAACTTGTCAGG -3'
(R):5'- TCAGTGCTATCCTGACGGCTAG -3'

Sequencing Primer
(F):5'- ACTGGGGTCTGTCCACCTG -3'
(R):5'- TATCCTGACGGCTAGAGGGAC -3'
Posted On2017-01-03