Incidental Mutation 'R5707:Ttc25'
ID452040
Institutional Source Beutler Lab
Gene Symbol Ttc25
Ensembl Gene ENSMUSG00000006784
Gene Nametetratricopeptide repeat domain 25
Synonyms
MMRRC Submission 043332-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R5707 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location100545607-100572568 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 100554061 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 348 (A348T)
Ref Sequence ENSEMBL: ENSMUSP00000090355 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006976] [ENSMUST00000092684]
Predicted Effect probably damaging
Transcript: ENSMUST00000006976
AA Change: A348T

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000006976
Gene: ENSMUSG00000006784
AA Change: A348T

DomainStartEndE-ValueType
TPR 11 44 3.69e1 SMART
TPR 45 78 3.07e1 SMART
TPR 79 112 4.96e0 SMART
low complexity region 147 158 N/A INTRINSIC
low complexity region 191 208 N/A INTRINSIC
TPR 318 351 4.96e0 SMART
TPR 358 391 1.11e1 SMART
Blast:TPR 395 428 7e-14 BLAST
TPR 435 468 2.99e1 SMART
low complexity region 493 505 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000092684
AA Change: A348T

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000090355
Gene: ENSMUSG00000006784
AA Change: A348T

DomainStartEndE-ValueType
TPR 11 44 3.69e1 SMART
TPR 45 78 3.07e1 SMART
TPR 79 112 4.96e0 SMART
low complexity region 147 158 N/A INTRINSIC
low complexity region 191 208 N/A INTRINSIC
TPR 318 351 4.96e0 SMART
TPR 358 391 1.11e1 SMART
Blast:TPR 395 428 5e-14 BLAST
TPR 435 468 2.99e1 SMART
coiled coil region 528 548 N/A INTRINSIC
low complexity region 556 567 N/A INTRINSIC
coiled coil region 599 624 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127389
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132143
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150331
Meta Mutation Damage Score 0.1220 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 97% (56/58)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele display partial preweaning lethality, impaired ciliary motility, and a variety of left-right body symmetry defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700125H20Rik A G 11: 85,173,312 N93S probably benign Het
9330182L06Rik A G 5: 9,441,698 Y686C probably damaging Het
Abca13 T C 11: 9,510,620 L4210P probably damaging Het
Adcy6 T C 15: 98,598,741 T518A probably damaging Het
Adgb C T 10: 10,391,757 V940I probably damaging Het
Aqp11 A G 7: 97,737,428 V187A possibly damaging Het
Arhgef15 A G 11: 68,954,715 S104P probably damaging Het
BC027072 G T 17: 71,751,572 A370E possibly damaging Het
Birc6 T A 17: 74,696,404 N4762K probably damaging Het
Cacna1e T C 1: 154,633,717 D264G probably damaging Het
Cela3b G T 4: 137,424,856 Q97K probably damaging Het
Cenpc1 T A 5: 86,035,434 R499W possibly damaging Het
Cnr1 C A 4: 33,944,330 C239* probably null Het
Col6a2 T C 10: 76,611,031 K348E possibly damaging Het
Ctnnb1 C A 9: 120,955,168 L368I probably benign Het
Diras1 T C 10: 81,022,081 E112G probably benign Het
Dopey1 T A 9: 86,502,997 M332K possibly damaging Het
Dpy19l1 T C 9: 24,414,267 *747W probably null Het
Dydc2 T G 14: 41,061,954 T71P probably damaging Het
Ggt1 T A 10: 75,585,238 I429N probably benign Het
Gm5114 G C 7: 39,411,276 L50V probably benign Het
Gm5121 T G 9: 57,334,483 noncoding transcript Het
Kidins220 A G 12: 25,013,391 D933G probably damaging Het
Kirrel3 A G 9: 35,013,276 K286R probably damaging Het
Klf5 T C 14: 99,301,508 I39T probably benign Het
Krt14 C T 11: 100,204,758 V274I possibly damaging Het
Meiob A G 17: 24,835,051 D364G probably benign Het
Mroh7 T A 4: 106,681,885 E1190D possibly damaging Het
Mtmr7 T C 8: 40,558,162 E285G possibly damaging Het
Nhsl1 C T 10: 18,526,503 T1159M probably damaging Het
Olfr1360 A G 13: 21,674,599 L115P probably damaging Het
Olfr366 C A 2: 37,219,889 N133K probably benign Het
Olfr382 G T 11: 73,516,625 D191E probably damaging Het
Pdlim5 T A 3: 142,304,299 H294L probably damaging Het
Pdzd8 A T 19: 59,299,625 D1114E probably benign Het
Phf20 T G 2: 156,296,771 probably null Het
Plec C T 15: 76,199,671 probably benign Het
Ppp1r18 T C 17: 35,867,236 M1T probably null Het
Ppp4r3a G A 12: 101,058,511 T243I probably damaging Het
Prss41 C T 17: 23,842,416 V134I probably benign Het
Pter T C 2: 12,978,180 probably benign Het
Rasgef1b T G 5: 99,234,602 K176N possibly damaging Het
Reps1 T A 10: 18,056,010 D16E probably benign Het
Slc4a5 T A 6: 83,261,415 D73E probably benign Het
Smgc A T 15: 91,860,663 T146S possibly damaging Het
Sptbn1 A T 11: 30,143,174 W396R possibly damaging Het
Stkld1 A G 2: 26,943,987 E162G probably damaging Het
Tanc1 T C 2: 59,758,530 F106L probably benign Het
Tarbp1 A G 8: 126,467,144 Y340H probably damaging Het
Tenm2 T C 11: 36,047,182 I1556V possibly damaging Het
Tmem64 T C 4: 15,266,288 C113R probably damaging Het
Try4 T C 6: 41,305,043 F188L possibly damaging Het
Ucn3 A G 13: 3,941,556 V32A probably benign Het
Vmn2r83 T A 10: 79,491,349 M597K possibly damaging Het
Wdr90 A G 17: 25,857,192 V491A probably benign Het
Xylt1 T A 7: 117,656,494 M763K possibly damaging Het
Zfp507 G T 7: 35,794,163 A485E probably damaging Het
Other mutations in Ttc25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02027:Ttc25 APN 11 100569902 missense probably damaging 1.00
IGL02379:Ttc25 APN 11 100566983 missense possibly damaging 0.87
IGL03091:Ttc25 APN 11 100550250 nonsense probably null
IGL02991:Ttc25 UTSW 11 100553872 missense probably benign 0.01
R0044:Ttc25 UTSW 11 100567001 missense probably damaging 1.00
R0137:Ttc25 UTSW 11 100563568 missense probably damaging 1.00
R0280:Ttc25 UTSW 11 100550265 missense probably damaging 1.00
R1373:Ttc25 UTSW 11 100545832 missense probably damaging 1.00
R1793:Ttc25 UTSW 11 100569853 splice site probably null
R2097:Ttc25 UTSW 11 100563582 missense possibly damaging 0.89
R2121:Ttc25 UTSW 11 100567011 critical splice donor site probably null
R2509:Ttc25 UTSW 11 100553535 missense probably damaging 0.99
R2655:Ttc25 UTSW 11 100553579 missense probably damaging 1.00
R4635:Ttc25 UTSW 11 100551507 nonsense probably null
R4773:Ttc25 UTSW 11 100549916 missense probably benign 0.05
R4858:Ttc25 UTSW 11 100550321 missense probably damaging 0.96
R5164:Ttc25 UTSW 11 100571520 nonsense probably null
R5181:Ttc25 UTSW 11 100549893 missense probably damaging 1.00
R5742:Ttc25 UTSW 11 100545873 missense possibly damaging 0.90
R7634:Ttc25 UTSW 11 100561905 critical splice donor site probably null
R7851:Ttc25 UTSW 11 100545829 missense probably damaging 1.00
R8186:Ttc25 UTSW 11 100563679 missense probably benign 0.27
R8194:Ttc25 UTSW 11 100563676 missense probably benign 0.06
R8444:Ttc25 UTSW 11 100561905 critical splice donor site probably null
X0018:Ttc25 UTSW 11 100553598 missense probably damaging 0.99
X0028:Ttc25 UTSW 11 100545898 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTTGACCTCCGTGTCAACTC -3'
(R):5'- AGTTACCAGCCTAGGTTTGCTTTC -3'

Sequencing Primer
(F):5'- ACCAGTGGCAGTGCTGATG -3'
(R):5'- AGGTTTGCTTTCTACCCTCAG -3'
Posted On2017-01-03