Incidental Mutation 'R5707:BC027072'
ID452054
Institutional Source Beutler Lab
Gene Symbol BC027072
Ensembl Gene ENSMUSG00000044375
Gene NamecDNA sequence BC027072
Synonyms
MMRRC Submission 043332-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R5707 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location71743557-71752885 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 71751572 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 370 (A370E)
Ref Sequence ENSEMBL: ENSMUSP00000051871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057405]
Predicted Effect possibly damaging
Transcript: ENSMUST00000057405
AA Change: A370E

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000051871
Gene: ENSMUSG00000044375
AA Change: A370E

DomainStartEndE-ValueType
Pfam:Retinal 1 1255 N/A PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is highly expressed in photoreceptors and may associate with the primary cilium of the outer segment. The encoded protein appears to undergo post-translational lipid modification. Nonsense and missense variants of this gene appear to cause a recessive form of retinitis pigmentosa. [provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for a knock-out allele develop severe early-onset retinal degeneration associated with a disorganized outer segment, progressive thinning of the outer nuclear layer, microglia activation, decreased a- and b-wave amplitudes, and nearly undetectable ERG responses by 8 weeks of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700125H20Rik A G 11: 85,173,312 N93S probably benign Het
9330182L06Rik A G 5: 9,441,698 Y686C probably damaging Het
Abca13 T C 11: 9,510,620 L4210P probably damaging Het
Adcy6 T C 15: 98,598,741 T518A probably damaging Het
Adgb C T 10: 10,391,757 V940I probably damaging Het
Aqp11 A G 7: 97,737,428 V187A possibly damaging Het
Arhgef15 A G 11: 68,954,715 S104P probably damaging Het
Birc6 T A 17: 74,696,404 N4762K probably damaging Het
Cacna1e T C 1: 154,633,717 D264G probably damaging Het
Cela3b G T 4: 137,424,856 Q97K probably damaging Het
Cenpc1 T A 5: 86,035,434 R499W possibly damaging Het
Cnr1 C A 4: 33,944,330 C239* probably null Het
Col6a2 T C 10: 76,611,031 K348E possibly damaging Het
Ctnnb1 C A 9: 120,955,168 L368I probably benign Het
Diras1 T C 10: 81,022,081 E112G probably benign Het
Dopey1 T A 9: 86,502,997 M332K possibly damaging Het
Dpy19l1 T C 9: 24,414,267 *747W probably null Het
Dydc2 T G 14: 41,061,954 T71P probably damaging Het
Ggt1 T A 10: 75,585,238 I429N probably benign Het
Gm5114 G C 7: 39,411,276 L50V probably benign Het
Gm5121 T G 9: 57,334,483 noncoding transcript Het
Kidins220 A G 12: 25,013,391 D933G probably damaging Het
Kirrel3 A G 9: 35,013,276 K286R probably damaging Het
Klf5 T C 14: 99,301,508 I39T probably benign Het
Krt14 C T 11: 100,204,758 V274I possibly damaging Het
Meiob A G 17: 24,835,051 D364G probably benign Het
Mroh7 T A 4: 106,681,885 E1190D possibly damaging Het
Mtmr7 T C 8: 40,558,162 E285G possibly damaging Het
Nhsl1 C T 10: 18,526,503 T1159M probably damaging Het
Olfr1360 A G 13: 21,674,599 L115P probably damaging Het
Olfr366 C A 2: 37,219,889 N133K probably benign Het
Olfr382 G T 11: 73,516,625 D191E probably damaging Het
Pdlim5 T A 3: 142,304,299 H294L probably damaging Het
Pdzd8 A T 19: 59,299,625 D1114E probably benign Het
Phf20 T G 2: 156,296,771 probably null Het
Plec C T 15: 76,199,671 probably benign Het
Ppp1r18 T C 17: 35,867,236 M1T probably null Het
Ppp4r3a G A 12: 101,058,511 T243I probably damaging Het
Prss41 C T 17: 23,842,416 V134I probably benign Het
Pter T C 2: 12,978,180 probably benign Het
Rasgef1b T G 5: 99,234,602 K176N possibly damaging Het
Reps1 T A 10: 18,056,010 D16E probably benign Het
Slc4a5 T A 6: 83,261,415 D73E probably benign Het
Smgc A T 15: 91,860,663 T146S possibly damaging Het
Sptbn1 A T 11: 30,143,174 W396R possibly damaging Het
Stkld1 A G 2: 26,943,987 E162G probably damaging Het
Tanc1 T C 2: 59,758,530 F106L probably benign Het
Tarbp1 A G 8: 126,467,144 Y340H probably damaging Het
Tenm2 T C 11: 36,047,182 I1556V possibly damaging Het
Tmem64 T C 4: 15,266,288 C113R probably damaging Het
Try4 T C 6: 41,305,043 F188L possibly damaging Het
Ttc25 G A 11: 100,554,061 A348T probably damaging Het
Ucn3 A G 13: 3,941,556 V32A probably benign Het
Vmn2r83 T A 10: 79,491,349 M597K possibly damaging Het
Wdr90 A G 17: 25,857,192 V491A probably benign Het
Xylt1 T A 7: 117,656,494 M763K possibly damaging Het
Zfp507 G T 7: 35,794,163 A485E probably damaging Het
Other mutations in BC027072
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02010:BC027072 APN 17 71749464 missense probably benign 0.38
IGL02033:BC027072 APN 17 71751081 missense probably damaging 1.00
IGL02711:BC027072 APN 17 71749382 missense probably benign 0.15
IGL03185:BC027072 APN 17 71749337 missense probably damaging 0.98
IGL03242:BC027072 APN 17 71750271 missense probably benign 0.01
R0367:BC027072 UTSW 17 71750476 missense probably damaging 1.00
R0413:BC027072 UTSW 17 71752217 missense probably benign 0.38
R0465:BC027072 UTSW 17 71750160 missense probably benign 0.42
R0535:BC027072 UTSW 17 71752439 missense probably benign 0.01
R0681:BC027072 UTSW 17 71749514 missense probably benign 0.00
R0736:BC027072 UTSW 17 71744664 missense probably benign 0.00
R1406:BC027072 UTSW 17 71749161 missense probably benign 0.18
R1406:BC027072 UTSW 17 71749161 missense probably benign 0.18
R1530:BC027072 UTSW 17 71749478 missense probably benign 0.01
R1723:BC027072 UTSW 17 71750378 missense probably damaging 1.00
R1941:BC027072 UTSW 17 71752068 missense probably damaging 1.00
R2179:BC027072 UTSW 17 71752526 missense probably damaging 1.00
R2232:BC027072 UTSW 17 71749284 missense probably benign 0.00
R2519:BC027072 UTSW 17 71751647 missense probably damaging 1.00
R2997:BC027072 UTSW 17 71744711 critical splice acceptor site probably benign
R3899:BC027072 UTSW 17 71750160 missense probably benign 0.00
R4890:BC027072 UTSW 17 71752311 missense possibly damaging 0.50
R4898:BC027072 UTSW 17 71751071 missense probably damaging 1.00
R5347:BC027072 UTSW 17 71749935 missense probably benign 0.00
R5436:BC027072 UTSW 17 71750842 missense probably damaging 1.00
R5527:BC027072 UTSW 17 71752640 missense probably damaging 1.00
R5556:BC027072 UTSW 17 71752425 missense possibly damaging 0.81
R5625:BC027072 UTSW 17 71751326 missense probably damaging 1.00
R5932:BC027072 UTSW 17 71751753 missense probably damaging 1.00
R6043:BC027072 UTSW 17 71750042 missense probably damaging 1.00
R6314:BC027072 UTSW 17 71752457 missense probably benign 0.04
R6513:BC027072 UTSW 17 71744706 missense probably damaging 1.00
R7575:BC027072 UTSW 17 71750855 missense probably damaging 1.00
R7638:BC027072 UTSW 17 71750885 missense probably damaging 1.00
R7848:BC027072 UTSW 17 71749193 missense probably benign 0.04
R7931:BC027072 UTSW 17 71749193 missense probably benign 0.04
R8317:BC027072 UTSW 17 71749202 missense probably benign 0.10
X0035:BC027072 UTSW 17 71744711 critical splice acceptor site probably benign
Z1177:BC027072 UTSW 17 71750403 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAAAGTGGTGTCCGCACAG -3'
(R):5'- ATGAATGTCTCCTCAGGGCC -3'

Sequencing Primer
(F):5'- TTTCGGCAGCCTCTGAAG -3'
(R):5'- ATCGGTGCTGACAATGAG -3'
Posted On2017-01-03