Incidental Mutation 'R5708:Gmeb2'
ID452064
Institutional Source Beutler Lab
Gene Symbol Gmeb2
Ensembl Gene ENSMUSG00000038705
Gene Nameglucocorticoid modulatory element binding protein 2
Synonyms
MMRRC Submission 043333-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.170) question?
Stock #R5708 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location181251449-181288035 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 181264989 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 117 (C117S)
Ref Sequence ENSEMBL: ENSMUSP00000037075 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049032] [ENSMUST00000130475] [ENSMUST00000141003] [ENSMUST00000141110]
Predicted Effect probably damaging
Transcript: ENSMUST00000049032
AA Change: C117S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037075
Gene: ENSMUSG00000038705
AA Change: C117S

DomainStartEndE-ValueType
low complexity region 6 18 N/A INTRINSIC
SAND 90 163 1.66e-42 SMART
coiled coil region 304 347 N/A INTRINSIC
low complexity region 414 426 N/A INTRINSIC
low complexity region 475 488 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000130475
AA Change: C117S

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000116479
Gene: ENSMUSG00000038705
AA Change: C117S

DomainStartEndE-ValueType
low complexity region 6 18 N/A INTRINSIC
SAND 90 163 1.66e-42 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000141003
AA Change: C117S

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000116854
Gene: ENSMUSG00000038705
AA Change: C117S

DomainStartEndE-ValueType
low complexity region 6 18 N/A INTRINSIC
Pfam:SAND 81 126 7.9e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141110
SMART Domains Protein: ENSMUSP00000115853
Gene: ENSMUSG00000038705

DomainStartEndE-ValueType
low complexity region 6 18 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147665
Meta Mutation Damage Score 0.9507 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of KDWK gene family. The product of this gene associates with GMEB1 protein, and the complex is essential for parvovirus DNA replication. Study of rat homolog implicates the role of this gene in modulation of transactivation by the glucocorticoid receptor bound to glucocorticoid response elements. This gene appears to use multiple polyadenylation sites. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik A T 5: 98,737,707 M158L probably benign Het
1700067K01Rik A G 8: 84,002,998 K101R probably benign Het
4933430I17Rik T C 4: 62,525,869 S18P probably benign Het
Adgb C T 10: 10,391,757 V940I probably damaging Het
Aox4 G T 1: 58,245,873 A595S possibly damaging Het
Asxl2 T A 12: 3,500,603 S782T possibly damaging Het
C1s2 A T 6: 124,625,743 L503* probably null Het
C7 A G 15: 5,015,401 V385A possibly damaging Het
Cdh20 T C 1: 104,984,910 F630L probably damaging Het
Cdk14 A C 5: 5,266,036 probably benign Het
Cdkl4 T C 17: 80,539,522 I239M possibly damaging Het
Col11a1 A G 3: 114,097,094 N360S unknown Het
D630003M21Rik A G 2: 158,220,392 probably null Het
Dchs1 G A 7: 105,772,809 P135S probably damaging Het
Dpysl2 A G 14: 66,813,146 S421P probably benign Het
Edn1 A T 13: 42,303,667 M59L probably benign Het
EU599041 A G 7: 43,225,887 noncoding transcript Het
Fam196a C A 7: 134,918,796 V2F probably damaging Het
Furin A G 7: 80,397,855 probably benign Het
Gkn2 T C 6: 87,377,436 L94P probably damaging Het
Greb1 T A 12: 16,673,842 I1869F probably benign Het
Heg1 A G 16: 33,742,404 E1119G probably damaging Het
Hmgcs2 T A 3: 98,291,162 L127Q probably damaging Het
Kcnh6 A G 11: 106,020,256 R493G probably benign Het
Kcnj11 C T 7: 46,099,818 R27H probably benign Het
Klra14-ps A G 6: 130,157,788 noncoding transcript Het
Lgmn A T 12: 102,404,328 N114K possibly damaging Het
Lipg C T 18: 74,955,434 M148I possibly damaging Het
Megf8 G T 7: 25,334,597 R607L probably benign Het
Mks1 A G 11: 87,856,839 T183A probably benign Het
Mllt11 A G 3: 95,220,204 V85A probably benign Het
Mpo A T 11: 87,801,755 probably null Het
Muc4 A T 16: 32,754,769 probably benign Het
Myoz3 T C 18: 60,579,032 Y158C probably damaging Het
Olfr1287 A G 2: 111,450,009 R290G probably damaging Het
Olfr290 A G 7: 84,916,183 I135V possibly damaging Het
Olfr741 A T 14: 50,485,995 D179V probably damaging Het
Polq T A 16: 37,061,018 S902R probably damaging Het
Rarb T C 14: 16,548,545 T93A probably damaging Het
Rgs12 A G 5: 34,966,352 D493G probably benign Het
Sec31b T A 19: 44,523,144 D606V probably damaging Het
Setd2 T C 9: 110,548,823 F569L possibly damaging Het
Sil1 T C 18: 35,341,117 E149G probably benign Het
Spata13 T G 14: 60,692,003 S337A probably damaging Het
Srfbp1 T A 18: 52,488,946 L360M probably damaging Het
Tecta A T 9: 42,338,926 C1852S probably damaging Het
Tgfbr3l A G 8: 4,250,360 T208A probably damaging Het
Tmem38b G C 4: 53,849,051 probably null Het
Tnfrsf11a T A 1: 105,813,820 probably null Het
Tnik T A 3: 28,611,971 probably null Het
Tsc1 A T 2: 28,665,185 probably benign Het
Zfp930 T C 8: 69,226,461 V41A probably benign Het
Zscan18 A T 7: 12,774,456 D372E probably benign Het
Other mutations in Gmeb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00978:Gmeb2 APN 2 181259043 missense probably benign 0.18
IGL02882:Gmeb2 APN 2 181265883 missense probably damaging 0.98
R0437:Gmeb2 UTSW 2 181253973 missense possibly damaging 0.83
R1499:Gmeb2 UTSW 2 181255226 missense probably benign 0.01
R2064:Gmeb2 UTSW 2 181253970 missense probably benign 0.42
R2127:Gmeb2 UTSW 2 181259049 missense probably benign 0.21
R2517:Gmeb2 UTSW 2 181259026 missense probably benign 0.12
R3087:Gmeb2 UTSW 2 181255640 splice site probably benign
R4202:Gmeb2 UTSW 2 181253973 missense possibly damaging 0.83
R4470:Gmeb2 UTSW 2 181265145 intron probably null
R4936:Gmeb2 UTSW 2 181254246 missense probably benign 0.04
R5296:Gmeb2 UTSW 2 181255986 intron probably benign
R5402:Gmeb2 UTSW 2 181255957 splice site probably null
R5934:Gmeb2 UTSW 2 181255574 missense possibly damaging 0.63
R7673:Gmeb2 UTSW 2 181260388 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGCATTCATCAGTCCCAGAG -3'
(R):5'- TCCTAGGCTCTGTTTCAGGC -3'

Sequencing Primer
(F):5'- GCATTCATCAGTCCCAGAGATTATC -3'
(R):5'- TGGATCTCCTTTCAGTTTCAGG -3'
Posted On2017-01-03