Incidental Mutation 'R5708:Hmgcs2'
ID452067
Institutional Source Beutler Lab
Gene Symbol Hmgcs2
Ensembl Gene ENSMUSG00000027875
Gene Name3-hydroxy-3-methylglutaryl-Coenzyme A synthase 2
SynonymsmHS
MMRRC Submission 043333-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.117) question?
Stock #R5708 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location98280435-98310738 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 98291162 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 127 (L127Q)
Ref Sequence ENSEMBL: ENSMUSP00000113296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090746] [ENSMUST00000120541]
Predicted Effect probably damaging
Transcript: ENSMUST00000090746
AA Change: L127Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000088249
Gene: ENSMUSG00000027875
AA Change: L127Q

DomainStartEndE-ValueType
Pfam:HMG_CoA_synt_N 50 223 2.9e-111 PFAM
Pfam:HMG_CoA_synt_C 224 506 6.6e-131 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000120541
AA Change: L127Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113296
Gene: ENSMUSG00000027875
AA Change: L127Q

DomainStartEndE-ValueType
Pfam:HMG_CoA_synt_N 50 223 7.2e-108 PFAM
Pfam:HMG_CoA_synt_C 224 506 1.8e-131 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196040
Meta Mutation Damage Score 0.9527 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the HMG-CoA synthase family. It is a mitochondrial enzyme that catalyzes the first reaction of ketogenesis, a metabolic pathway that provides lipid-derived energy for various organs during times of carbohydrate deprivation, such as fasting. Mutations in this gene are associated with HMG-CoA synthase deficiency. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik A T 5: 98,737,707 M158L probably benign Het
1700067K01Rik A G 8: 84,002,998 K101R probably benign Het
4933430I17Rik T C 4: 62,525,869 S18P probably benign Het
Adgb C T 10: 10,391,757 V940I probably damaging Het
Aox4 G T 1: 58,245,873 A595S possibly damaging Het
Asxl2 T A 12: 3,500,603 S782T possibly damaging Het
C1s2 A T 6: 124,625,743 L503* probably null Het
C7 A G 15: 5,015,401 V385A possibly damaging Het
Cdh20 T C 1: 104,984,910 F630L probably damaging Het
Cdk14 A C 5: 5,266,036 probably benign Het
Cdkl4 T C 17: 80,539,522 I239M possibly damaging Het
Col11a1 A G 3: 114,097,094 N360S unknown Het
D630003M21Rik A G 2: 158,220,392 probably null Het
Dchs1 G A 7: 105,772,809 P135S probably damaging Het
Dpysl2 A G 14: 66,813,146 S421P probably benign Het
Edn1 A T 13: 42,303,667 M59L probably benign Het
EU599041 A G 7: 43,225,887 noncoding transcript Het
Fam196a C A 7: 134,918,796 V2F probably damaging Het
Furin A G 7: 80,397,855 probably benign Het
Gkn2 T C 6: 87,377,436 L94P probably damaging Het
Gmeb2 A T 2: 181,264,989 C117S probably damaging Het
Greb1 T A 12: 16,673,842 I1869F probably benign Het
Heg1 A G 16: 33,742,404 E1119G probably damaging Het
Kcnh6 A G 11: 106,020,256 R493G probably benign Het
Kcnj11 C T 7: 46,099,818 R27H probably benign Het
Klra14-ps A G 6: 130,157,788 noncoding transcript Het
Lgmn A T 12: 102,404,328 N114K possibly damaging Het
Lipg C T 18: 74,955,434 M148I possibly damaging Het
Megf8 G T 7: 25,334,597 R607L probably benign Het
Mks1 A G 11: 87,856,839 T183A probably benign Het
Mllt11 A G 3: 95,220,204 V85A probably benign Het
Mpo A T 11: 87,801,755 probably null Het
Muc4 A T 16: 32,754,769 probably benign Het
Myoz3 T C 18: 60,579,032 Y158C probably damaging Het
Olfr1287 A G 2: 111,450,009 R290G probably damaging Het
Olfr290 A G 7: 84,916,183 I135V possibly damaging Het
Olfr741 A T 14: 50,485,995 D179V probably damaging Het
Polq T A 16: 37,061,018 S902R probably damaging Het
Rarb T C 14: 16,548,545 T93A probably damaging Het
Rgs12 A G 5: 34,966,352 D493G probably benign Het
Sec31b T A 19: 44,523,144 D606V probably damaging Het
Setd2 T C 9: 110,548,823 F569L possibly damaging Het
Sil1 T C 18: 35,341,117 E149G probably benign Het
Spata13 T G 14: 60,692,003 S337A probably damaging Het
Srfbp1 T A 18: 52,488,946 L360M probably damaging Het
Tecta A T 9: 42,338,926 C1852S probably damaging Het
Tgfbr3l A G 8: 4,250,360 T208A probably damaging Het
Tmem38b G C 4: 53,849,051 probably null Het
Tnfrsf11a T A 1: 105,813,820 probably null Het
Tnik T A 3: 28,611,971 probably null Het
Tsc1 A T 2: 28,665,185 probably benign Het
Zfp930 T C 8: 69,226,461 V41A probably benign Het
Zscan18 A T 7: 12,774,456 D372E probably benign Het
Other mutations in Hmgcs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0579:Hmgcs2 UTSW 3 98290948 missense probably damaging 1.00
R0657:Hmgcs2 UTSW 3 98291053 missense probably benign
R0724:Hmgcs2 UTSW 3 98297001 nonsense probably null
R2024:Hmgcs2 UTSW 3 98299214 missense probably damaging 1.00
R2109:Hmgcs2 UTSW 3 98297021 nonsense probably null
R2202:Hmgcs2 UTSW 3 98291183 missense probably damaging 1.00
R2203:Hmgcs2 UTSW 3 98291183 missense probably damaging 1.00
R2204:Hmgcs2 UTSW 3 98291183 missense probably damaging 1.00
R2205:Hmgcs2 UTSW 3 98291183 missense probably damaging 1.00
R3758:Hmgcs2 UTSW 3 98291090 missense probably damaging 1.00
R3779:Hmgcs2 UTSW 3 98299112 splice site probably benign
R3958:Hmgcs2 UTSW 3 98297477 missense possibly damaging 0.48
R3959:Hmgcs2 UTSW 3 98297477 missense possibly damaging 0.48
R3960:Hmgcs2 UTSW 3 98297477 missense possibly damaging 0.48
R3962:Hmgcs2 UTSW 3 98291038 missense possibly damaging 0.91
R4788:Hmgcs2 UTSW 3 98291084 missense probably damaging 1.00
R5102:Hmgcs2 UTSW 3 98280470 start gained probably benign
R5742:Hmgcs2 UTSW 3 98297516 missense probably benign
R7268:Hmgcs2 UTSW 3 98297480 missense probably benign 0.02
R7294:Hmgcs2 UTSW 3 98290895 missense probably benign 0.09
R7503:Hmgcs2 UTSW 3 98302624 missense probably damaging 1.00
R7767:Hmgcs2 UTSW 3 98291266 missense probably damaging 1.00
R8043:Hmgcs2 UTSW 3 98291128 missense probably damaging 1.00
Z1176:Hmgcs2 UTSW 3 98290945 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCCTGGAGGTCTATTTTCC -3'
(R):5'- TCCTGGAAACACGTACCATC -3'

Sequencing Primer
(F):5'- TATGTGGACCAAACTGACCTG -3'
(R):5'- CGTACCATCCCAGTAGCTG -3'
Posted On2017-01-03